HUGE

Gene/Protein Characteristic Table for KIAA1695

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05022
Accession No. :	AB051482
Description :	FH1/FH2 domain-containing protein 3.
HUGO Gene Name :	formin homology 2 domain containing 3 (FHOD3)
Clone Name :	fj11471 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4126 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 525 bp

Genome contig ID gi51511735f_32328747
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
ATGTTTCAAATACTAAATAAATAGAGTTTAATGCC
Flanking genome sequence
(285271 - 285320)
----+----*----+----*----+----*----+----*----+----*
ATAATGAGAAACTTTTATTCTTCTGGGAACAGGACCTTAAACAGTTCCAC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 18 f 32428747 32614016 18 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 1199 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAX01381	100.0	formin homology...	Homo sapiens
XP_001106575	98.7	similar to form...	Macaca mulatta
AAI57094	96.9	Formin homology...	synthetic construct
XP_001106689	95.7	similar to form...	Macaca mulatta
EAX01379	98.6	formin homology...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002379	4.9e-09	26.1	KIAA0381
AB051514	1.1e-06	24.9	KIAA1727
AB095934	1.2e-05	21.7	KIAA2014

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR015425 661 1031 PF02181 Actin-binding FH2

HMMSmart IPR003104 660 1105 SM00498 Actin-binding FH2 and DRF autoregulatory

ProfileScan IPR014768 1 248 PS51232 GTPase-binding/formin homology 3

IPR014767 1136 1168 PS51231 Diaphanous autoregulatory

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR015425	661	1031	PF02181	Actin-binding FH2
HMMSmart	IPR003104	660	1105	SM00498	Actin-binding FH2 and DRF autoregulatory
ProfileScan	IPR014768	1	248	PS51232	GTPase-binding/formin homology 3
IPR014767	1136	1168	PS51231	Diaphanous autoregulatory

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TCTCTTGATTCCGTGACACCC

Primer_r
: ATTTTGGTGTTGTGGAGACTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 18

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	525 bp
Genome contig ID	gi51511735f_32328747
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- ATGTTTCAAATACTAAATAAATAGAGTTTAATGCC
Flanking genome sequence (285271 - 285320)	----+--------+--------+--------+--------+----* ATAATGAGAAACTTTTATTCTTCTGGGAACAGGACCTTAAACAGTTCCAC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	18	f	32428747	32614016	18	100.0	Perfect prediction

Primer_f	: TCTCTTGATTCCGTGACACCC
Primer_r	: ATTTTGGTGTTGTGGAGACTC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1695

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information