HUGE |
Gene/Protein Characteristic Table for KIAA0381 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00063 |
---|---|
Accession No. : | AB002379 |
Description : | Disheveled-associated activator of morphogenesis 2. |
HUGO Gene Name : | dishevelled associated activator of morphogenesis 2 (DAAM2) |
Clone Name : | ah04695 [Vector Info] |
Flexi ORF Clone : | pF1KA0381
![]() |
Source : | Human brain (amygdala) |
Note : | We replaced hh00540, former representative clones for KIAA0381 with ah04695. (2005/08/06) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6177 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 2831 bp Genome contig ID gi89161210f_39768137 PolyA signal sequence
(ATTAAA,-24) +----*----+----*----+----*----+----
TACTAAAAAATATTAAATTCATACCATCCCTACCCFlanking genome sequence
(212487 - 212536) ----+----*----+----*----+----*----+----*----+----*
AGTCTGCCTTTAAACTTGTGCCTTCTTCCTATGAGGGGATCTGGGGTGGG
Chr f/r start end exon identity class ContigView(URL based/DAS) 6 f 39868137 39980622 25 100.0 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1114 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
: AAGGTGCAAGTGAAAAAGGAC | |
: ATCTCCCCCGACTTCTACCAG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 6 |
: GeneBridge 4 | |
: AAGGTGCAAGTGAAAAAGGAC | |
: ATCTCCCCCGACTTCTACCAG | |
: 117 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |