HUGE

Gene/Protein Characteristic Table for KIAA1902

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01184
Accession No. :	AB067489
Description :	Formin-like protein 2.
HUGO Gene Name :	formin-like 2 (FMNL2)
Clone Name :	hj04383 [Vector Info]
Flexi ORF Clone :	pF1KA1902
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5344 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1927 bp

Genome contig ID gi89161199f_152800229
PolyA signal sequence
(AATAAA,-27)
+----*----+----*----+----*----+----
GAGCAAATAATAAACTATTTACACTACTATTCTGT
Flanking genome sequence
(414365 - 414414)
----+----*----+----*----+----*----+----*----+----*
AATATGTTGTAATCTTTCAATGGTACAATTTAGGGGGTTTTAGCAATATT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 f 152900229 153214592 26 99.8 Perfect prediction

Features of the protein sequence	Description

Length: 1112 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG11370	100.0	formin-like pro...	synthetic construct
XP_515836	99.9	formin-like 2 i...	Pan troglodytes
AAI67804	99.8	Formin-like 2 [...	synthetic construct
Q96PY5	99.0	Formin-like pro...	Homo sapiens
XP_001139667	98.9	formin-like 2 i...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB095934	9.6e-45	69.8	KIAA2014
AB002379	1.7e-13	26.9	KIAA0381
AB014566	2.9e-11	26.9	KIAA0666

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR000976 523 539 PR00049 Wilm's tumour protein

IPR000976 572 586 PR00049 Wilm's tumour protein

HMMPfam IPR010473 42 295 PF06371 Diaphanous GTPase-binding

IPR010472 297 503 PF06367 Diaphanous FH3

IPR015425 637 1002 PF02181 Actin-binding FH2

HMMSmart IPR003104 636 1073 SM00498 Actin-binding FH2 and DRF autoregulatory

ProfileScan IPR014768 42 488 PS51232 GTPase-binding/formin homology 3

IPR014767 1059 1098 PS51231 Diaphanous autoregulatory

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000976	523	539	PR00049	Wilm's tumour protein
IPR000976	572	586	PR00049	Wilm's tumour protein
HMMPfam	IPR010473	42	295	PF06371	Diaphanous GTPase-binding
IPR010472	297	503	PF06367	Diaphanous FH3
IPR015425	637	1002	PF02181	Actin-binding FH2
HMMSmart	IPR003104	636	1073	SM00498	Actin-binding FH2 and DRF autoregulatory
ProfileScan	IPR014768	42	488	PS51232	GTPase-binding/formin homology 3
IPR014767	1059	1098	PS51231	Diaphanous autoregulatory

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GCTTCTGGCTTATCTTCTTGG

Primer_r
: ACTACACATCCAAGGAAAAGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1927 bp
Genome contig ID	gi89161199f_152800229
PolyA signal sequence (AATAAA,-27)	+--------+--------+----*----+---- GAGCAAATAATAAACTATTTACACTACTATTCTGT
Flanking genome sequence (414365 - 414414)	----+--------+--------+--------+--------+----* AATATGTTGTAATCTTTCAATGGTACAATTTAGGGGGTTTTAGCAATATT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	f	152900229	153214592	26	99.8	Perfect prediction

Primer_f	: GCTTCTGGCTTATCTTCTTGG
Primer_r	: ACTACACATCCAAGGAAAAGG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1902

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information