HUGE

Gene/Protein Characteristic Table for KIAA2014

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01701
Accession No. :	AB095934
Description :	Formin-like protein 3.
HUGO Gene Name :
Clone Name :	ff00951s1 [Vector Info]
Flexi ORF Clone :	pF1KA2014
Source :	Human fetal brain
Note :	We replaced ff00951, former representative clones for KIAA2014 with ff00951s1. (2005/08/06)

Features of the cloned DNA sequence	Description

Length: 11191 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 7873 bp

Genome contig ID gi89161190r_48218107
PolyA signal sequence
(AGTAAA,-18)
+----*----+----*----+----*----+----
CTGTATCCCTAGTGTGCAGTAAAGGATCACAGTAG
Flanking genome sequence
(99884 - 99835)
----+----*----+----*----+----*----+----*----+----*
ATATCTGCTGAACCAAGCTGTAATGCTTCTGCAAAACAGGACTTATCAGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 12 r 48317991 48387464 26 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 1032 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI59101	100.0	Formin-like 3 [...	Homo sapiens
XP_591526	97.9	similar to form...	Bos taurus
Q8IVF7	98.8	Formin-like pro...	Homo sapiens
EAW58086	98.6	formin-like 3, ...	Homo sapiens
XP_543681	97.5	similar to form...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB067489	5.5e-56	69.8	KIAA1902
AB002379	5e-17	27.0	KIAA0381
AB014566	3.1e-16	26.9	KIAA0666
AB051514	1.9e-10	28.7	KIAA1727
AB051482	4.5e-05	21.7	KIAA1695

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR010473 31 284 PF06371 Diaphanous GTPase-binding

IPR010472 286 487 PF06367 Diaphanous FH3

IPR015425 567 931 PF02181 Actin-binding FH2

HMMSmart IPR003104 566 1000 SM00498 Actin-binding FH2 and DRF autoregulatory

ProfileScan IPR014768 31 477 PS51232 GTPase-binding/formin homology 3

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR010473	31	284	PF06371	Diaphanous GTPase-binding
IPR010472	286	487	PF06367	Diaphanous FH3
IPR015425	567	931	PF02181	Actin-binding FH2
HMMSmart	IPR003104	566	1000	SM00498	Actin-binding FH2 and DRF autoregulatory
ProfileScan	IPR014768	31	477	PS51232	GTPase-binding/formin homology 3

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AGGAACTAGAGAGCATCAAGG

Primer_r
: TGGCTCCAAATGACATCGACG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 12

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	7873 bp
Genome contig ID	gi89161190r_48218107
PolyA signal sequence (AGTAAA,-18)	+--------+--------+----*----+---- CTGTATCCCTAGTGTGCAGTAAAGGATCACAGTAG
Flanking genome sequence (99884 - 99835)	----+--------+--------+--------+--------+----* ATATCTGCTGAACCAAGCTGTAATGCTTCTGCAAAACAGGACTTATCAGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	12	r	48317991	48387464	26	99.3	Perfect prediction

Primer_f	: AGGAACTAGAGAGCATCAAGG
Primer_r	: TGGCTCCAAATGACATCGACG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA2014

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information