Gene/Protein Characteristic Table for KIAA1727

Length: 6356 bp

Restriction map

Length of 3'UTR	2962 bp
Genome contig ID	gi89161207f_153983698
PolyA signal sequence (None)	+----*----+----*----+----*----+---- TAAAGTTCCTGTTTATGAGAGTCATGTTTCATCTC
Flanking genome sequence (136592 - 136641)	----+----*----+----*----+----*----+----*----+----* AGCTTCTTCCATGGATGTGTCTGTGTGATCTTGCTGGGAGAGTATTCAAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	4	f	154083698	154120288	11	99.2	Perfect prediction

Length: 1130 aa

Entry Exp ID% Protein Source XP_001085372 0 94.7 similar to form... Macaca mulatta EDM00822 0 72.2 similar to CG32... Rattus norvegicus Q3ULZ2 4.4e-216 72.2 FH2 domain-cont... Mus musculus EDL15405 6.4e-216 72.2 RIKEN cDNA 6330... Mus musculus BAE26306 7.8e-216 72.1 unnamed protein... Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% HUGE_ID AB014566 6.8e-10 27.3 KIAA0666 AB095934 1.6e-09 28.7 KIAA2014 AB051482 2.2e-05 24.2 KIAA1695

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR015425	75	444	PF02181	Actin-binding FH2
HMMSmart	IPR003104	74	514	SM00498	Actin-binding FH2 and DRF autoregulatory

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-