HUGE

Gene/Protein Characteristic Table for KIAA0666

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00599
Accession No. :	AB014566
Description :	Disheveled-associated activator of morphogenesis 1.
HUGO Gene Name :	dishevelled associated activator of morphogenesis 1 (DAAM1)
Clone Name :	hk02075 [Vector Info]
Flexi ORF Clone :	pF1KSDA0666
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4153 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Features of the protein sequence	Description

Length: 1085 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9Y4D1	100.0	Disheveled-asso...	Homo sapiens
XP_001093607	99.3	similar to dish...	Macaca mulatta
XP_852088	98.6	similar to dish...	Canis lupus fam...
XP_001497343	98.5	dishevelled ass...	Equus caballus
XP_865057	97.7	similar to dish...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002379	1.3e-66	67.7	KIAA0381
AB095934	4.8e-14	26.8	KIAA2014
AB067489	1.3e-12	27.1	KIAA1902
AB051514	3e-09	26.9	KIAA1727

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR010473 52 240 PF06371 Diaphanous GTPase-binding

IPR010472 242 448 PF06367 Diaphanous FH3

IPR015425 608 991 PF02181 Actin-binding FH2

HMMSmart IPR003104 607 1078 SM00498 Actin-binding FH2 and DRF autoregulatory

ProfileScan IPR014768 52 427 PS51232 GTPase-binding/formin homology 3

IPR014767 1034 1065 PS51231 Diaphanous autoregulatory

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR010473	52	240	PF06371	Diaphanous GTPase-binding
IPR010472	242	448	PF06367	Diaphanous FH3
IPR015425	608	991	PF02181	Actin-binding FH2
HMMSmart	IPR003104	607	1078	SM00498	Actin-binding FH2 and DRF autoregulatory
ProfileScan	IPR014768	52	427	PS51232	GTPase-binding/formin homology 3
IPR014767	1034	1065	PS51231	Diaphanous autoregulatory

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description
: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CACATCAGTAATAGGACCAGC

Primer_r
: GCACTTGGCAGAGATAACTTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 14

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CACATCAGTAATAGGACCAGC
Primer_r	: GCACTTGGCAGAGATAACTTG
PCR product length	: 184 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Gene/Protein Characteristic Table for KIAA0666

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information