HUGE

Gene/Protein Characteristic Table for KIAA1900

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05769
Accession No. :	AB067487
Description :	Kelch-like protein 32.
HUGO Gene Name :
Clone Name :	fk07650 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 3221 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1472 bp

Genome contig ID gi89161210f_97430685
PolyA signal sequence
(AATAAA,-27)
+----*----+----*----+----*----+----
CAAAAGTGAATAAAAACGATCTTTTTGTCTTACAG
Flanking genome sequence
(264668 - 264717)
----+----*----+----*----+----*----+----*----+----*
AATTCACTAACTTCATATATCGTTATACACAAAACATTGAAAATACATAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 6 f 97530685 97695351 9 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 582 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_518646	99.7	similar to RP1-...	Pan troglodytes
BAB70899	99.8	unnamed protein...	Homo sapiens
XP_001503889	98.6	kelch-like 32 (...	Equus caballus
XP_872392	98.3	similar to Kelc...	Bos taurus
CAM14812	98.5	kelch-like 32 (...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037805	1.3e-33	28.7	KIAA1384
AB037775	6e-26	36.8	KIAA1354
AB037730	1.5e-24	36.7	KIAA1309
AB067508	1.7e-21	24.7	KIAA1921
AB032955	2.1e-21	28.5	KIAA1129

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR013069 2 101 PF00651 BTB/POZ

IPR011705 106 207 PF07707 BTB/Kelch-associated

IPR006652 297 347 PF01344 Kelch repeat type 1

IPR006652 349 395 PF01344 Kelch repeat type 1

IPR006652 397 443 PF01344 Kelch repeat type 1

IPR006652 445 495 PF01344 Kelch repeat type 1

IPR006652 503 548 PF01344 Kelch repeat type 1

HMMSmart IPR000210 4 101 SM00225 BTB/POZ-like

IPR006652 252 308 SM00612 Kelch repeat type 1

IPR006652 309 360 SM00612 Kelch repeat type 1

IPR006652 361 408 SM00612 Kelch repeat type 1

IPR006652 409 456 SM00612 Kelch repeat type 1

IPR006652 457 509 SM00612 Kelch repeat type 1

ProfileScan IPR000210 4 71 PS50097 BTB/POZ-like

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013069	2	101	PF00651	BTB/POZ
IPR011705	106	207	PF07707	BTB/Kelch-associated
IPR006652	297	347	PF01344	Kelch repeat type 1
IPR006652	349	395	PF01344	Kelch repeat type 1
IPR006652	397	443	PF01344	Kelch repeat type 1
IPR006652	445	495	PF01344	Kelch repeat type 1
IPR006652	503	548	PF01344	Kelch repeat type 1
HMMSmart	IPR000210	4	101	SM00225	BTB/POZ-like
IPR006652	252	308	SM00612	Kelch repeat type 1
IPR006652	309	360	SM00612	Kelch repeat type 1
IPR006652	361	408	SM00612	Kelch repeat type 1
IPR006652	409	456	SM00612	Kelch repeat type 1
IPR006652	457	509	SM00612	Kelch repeat type 1
ProfileScan	IPR000210	4	71	PS50097	BTB/POZ-like

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TGCTGGATATGTGGCTGATGG

Primer_r
: GATCCGGTCATTATTGTAGTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 6

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1472 bp
Genome contig ID	gi89161210f_97430685
PolyA signal sequence (AATAAA,-27)	+--------+--------+----*----+---- CAAAAGTGAATAAAAACGATCTTTTTGTCTTACAG
Flanking genome sequence (264668 - 264717)	----+--------+--------+--------+--------+----* AATTCACTAACTTCATATATCGTTATACACAAAACATTGAAAATACATAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	6	f	97530685	97695351	9	100.0	Perfect prediction

Primer_f	: TGCTGGATATGTGGCTGATGG
Primer_r	: GATCCGGTCATTATTGTAGTC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1900

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information