| HUGE |
Gene/Protein Characteristic Table for KIAA1951 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK00953 |
|---|---|
| Accession No. : | AB075831 |
| Description : | zinc finger protein 526. |
| HUGO Gene Name : | zinc finger protein 526 (ZNF526) |
| Clone Name : | fj05532 [Vector Info] |
| Flexi ORF Clone : | pF1KSDA1951
|
| Source : | Human fetal brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 3954 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Features of the protein sequence |
Description | |
|---|---|---|
Length: 679 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
| RT-PCR-ELISA | Description |
|---|
Experimental conditions
| : CGGCTTTGGCACAGAACTCAC | |
| : TGGTAGAGGAACTTGGTCATG | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 19 |
| : genbank | |
| : - | |
| : - | |
| : - | |
| : - |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage 
| |
