HUGE |
Gene/Protein Characteristic Table for KIAA2016 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK07685 |
---|---|
Accession No. : | AB095936 |
Description : | T-cell lymphoma invasion and metastasis 2 isoform b. |
HUGO Gene Name : | |
Clone Name : | pf04366 [Vector Info] |
Source : | Human brain (hippocampus) |
Note : | We replaced fk10510, former representative clones for KIAA2016 with pf04366. (2005/08/06) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6971 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 592 bp Genome contig ID gi89161210f_155095523 PolyA signal sequence
(AGTAAA,-19) +----*----+----*----+----*----+----
CTCTGCCAAGCTGTATAGTAAAAGGAAAATAAGTCFlanking genome sequence
(525025 - 525074) ----+----*----+----*----+----*----+----*----+----*
ACATCTGGTCATTGGCATTTGTATCGTCATTCTGTAAAGACAAAAGAGTA
Chr f/r start end exon identity class ContigView(URL based/DAS) 6 f 155195523 155620546 29 99.8 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1715 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: CTTTTGCTTCCGACATTGATG | |
: GAGTCCTTCTTCGCAGTATCC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 6 |
: genbank | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |