KIAA0151

Product ID	ORK00030
Accession No	D63485
Description	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase epsilon, transcript variant 1
Clone name	ha03241
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3221 bp) Predicted protein sequence (723 aa)
HaloTag ORF Clone	FHC00030
Flexi ORF Clone	FXC00030
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0151 by Kazusa Mouse cDNA Project

Length: 3221 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	744 bp
Genome contig ID	gi89161185f_204610461
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- CAAGAAGTGGAATAAATGTGGCCTTTGCTTCTGTT
Flanking genome sequence (126386 - 126435)	----+--------+--------+--------+--------+----* TCTGGTGGCTCTCCCTGGGCTGTGTCTGCAAGGCAGGGCTCTCAGCTGGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	f	204710461	204736845	22	99.7	Perfect prediction

Length: 723 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q14164	100.0	Inhibitor of nu...	Homo sapiens
AAQ02507	100.0	inhibitor of ka...	synthetic construct
AAI05925	99.9	IKK-related kin...	Homo sapiens
XP_001088252	97.3	IKK-related kin...	Macaca mulatta
XP_001915500	89.8	similar to Inhi...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018265	5e-14	31.0	KIAA0722
AB014523	5.7e-14	31.7	KIAA0623
AB011123	3.2e-11	29.4	KIAA0551
D86959	1.4e-10	29.2	KIAA0204
D86968	1.4e-10	29.0	KIAA0213

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	22	228	PD000001	Protein kinase
HMMPfam	IPR000719	16	228	PF00069	Protein kinase
HMMSmart	IPR001245	16	332	SM00219	Tyrosine protein kinase
HMMSmart	IPR002290	16	318	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	16	322	PS50011	Protein kinase
ScanRegExp	IPR000719	22	45	PS00107	Protein kinase

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	CTCTCATACGCCTTCCCACTC
Primer_r	TCGTTTGACCTACTGCCCTGG
PCR product length	102 bp
PCR conditions	95 °C15 sec66 °C120 sec30 cycles