Order Kazusa clone(s) from : ![]() |
Product ID | ORK05920 |
---|---|
Accession No | D86968 |
Description | mitogen-activated protein kinase kinase kinase 4, transcript variant 2 |
Clone name | ha04841s1 |
Vector information | |
cDNA sequence | DNA sequence (5396 bp) Predicted protein sequence (1626 aa) |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0213
by Kazusa Mouse cDNA Project
|
Note | We replaced ha04841, former representative clones for KIAA0213 with ha04841s1. (2002/12/27) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 514 bp |
---|---|
Genome contig ID | gi89161210f_161232749 |
PolyA signal sequence (AATAAA,-27) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (225659 - 225708) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 6 | f | 161332749 | 161458406 | 26 | 99.7 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR000719 | 1367 | 1607 | PD000001 | Protein kinase |
HMMPfam | IPR000719 | 1361 | 1619 | PF00069 | Protein kinase |
HMMSmart | IPR001245 | 1361 | 1619 | SM00219 | Tyrosine protein kinase |
IPR002290 | 1361 | 1619 | SM00220 | Serine/threonine protein kinase | |
ProfileScan | IPR000719 | 1361 | 1619 | PS50011 | Protein kinase |
ScanRegExp | IPR000719 | 1367 | 1390 | PS00107 | Protein kinase |
IPR008271 | 1477 | 1489 | PS00108 | Serine/threonine protein kinase |
Panel name | Genebridge 4 |
---|---|
Primer_f | ACTACTGTACACGGACCATCG |
Primer_r | TAAAAACAAGGTATGGGACGC |
PCR product length | 137 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |