KIAA0300

Product ID	ORK06322
Accession No	AB002298
Description	PDZ domain containing 2
Clone name	hf00389s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (11700 bp) Predicted protein sequence (2847 aa)
Source	Human adult brain
Rouge ID	mKIAA0300 by Kazusa Mouse cDNA Project
Note	We replaced hf00389, former representative clones for KIAA0300 with hf00389s1. (2003/4/2)

Length: 11700 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2792 bp
Genome contig ID	gi51511721f_31734750
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- ATTTTAAAAAAAATAAACACTCTGCTTACTACTTG
Flanking genome sequence (412046 - 412095)	----+--------+--------+--------+--------+----* ATTTTTTTTTTCTCTTTTGGCTGTTTGTTTGTTAATAATAGAGTAATATT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	5	f	31834743	32146794	24	99.3	Terminal No-hit

Length: 2847 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O15018	100.0	PDZ domain-cont...	Homo sapiens
EAX10777	100.0	hCG2039413, iso...	Homo sapiens
XP_526957	98.5	PDZ domain cont...	Pan troglodytes
AAK07661	92.6	PDZ domain-cont...	Homo sapiens
BAG65554	100.0	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001478	342	424	PF00595	PDZ/DHR/GLGF
	IPR001478	594	678	PF00595	PDZ/DHR/GLGF
	IPR001478	736	819	PF00595	PDZ/DHR/GLGF
	IPR001478	2630	2692	PF00595	PDZ/DHR/GLGF
	IPR001478	2758	2841	PF00595	PDZ/DHR/GLGF
HMMSmart	IPR001478	89	187	SM00228	PDZ/DHR/GLGF
	IPR001478	350	427	SM00228	PDZ/DHR/GLGF
	IPR001478	603	681	SM00228	PDZ/DHR/GLGF
	IPR001478	743	822	SM00228	PDZ/DHR/GLGF
	IPR001478	2639	2715	SM00228	PDZ/DHR/GLGF
	IPR001478	2766	2844	SM00228	PDZ/DHR/GLGF
ProfileScan	IPR001478	102	168	PS50106	PDZ/DHR/GLGF
	IPR001478	342	427	PS50106	PDZ/DHR/GLGF
	IPR001478	594	680	PS50106	PDZ/DHR/GLGF
	IPR001478	736	806	PS50106	PDZ/DHR/GLGF
	IPR001478	2630	2702	PS50106	PDZ/DHR/GLGF
	IPR001478	2758	2843	PS50106	PDZ/DHR/GLGF
ScanRegExp	IPR000719	745	775	PS00107	Protein kinase

Primer_f	GTGCCAATTAAGTCAACCATC
Primer_r	GTCCTACTAAAACTGTCATTG
PCR conditions	95 °C15 sec62 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GTGCCAATTAAGTCAACCATC
Primer_r	GTCCTACTAAAACTGTCATTG
PCR product length	195 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles