Gene/Protein Characteristic Table for KIAA0384
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK01078
Accession No AB002382
Description catenin (cadherin-associated protein), delta 1, transcript variant 4
Clone name hh00733
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (5423 bp)
Predicted protein sequence (967 aa)
Flexi ORF Clone FXC01078
Source Human adult brain
Rouge ID mKIAA0384 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 5423 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning Warning
Features of the protein sequence
Description

Length: 967 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAG11176 0 100.0 catenin delta-1...
synthetic construct
AAC39806 0 99.9 p120 catenin is...
Homo sapiens
XP_001097712 0 99.7 catenin (cadher...
Macaca mulatta
XP_001141713 0 99.7 catenin (cadher...
Pan troglodytes
O60716 0 99.9 Catenin delta-1...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000225 425 465 PF00514 Armadillo
IPR000225 468 509 PF00514 Armadillo
IPR000225 680 721 PF00514 Armadillo
IPR000225 727 767 PF00514 Armadillo
HMMSmart IPR000225 425 465 SM00185 Armadillo
IPR000225 468 509 SM00185 Armadillo
IPR000225 510 567 SM00185 Armadillo
IPR000225 569 616 SM00185 Armadillo
IPR000225 679 721 SM00185 Armadillo
IPR000225 727 767 SM00185 Armadillo
IPR000225 817 859 SM00185 Armadillo
ProfileScan IPR000225 436 473 PS50176 Armadillo
IPR000225 479 522 PS50176 Armadillo
IPR000225 738 775 PS50176 Armadillo
Expression profile
Description

RT-PCR
Experimental conditions
Primer_f AAGAGAAAAGGTATGGAGCAG
Primer_r GGGTAATAGAACAGCCGTGGG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 11
Experimental conditions
Panel name GeneBridge 4
Primer_f AAGAGAAAAGGTATGGAGCAG
Primer_r GGGTAATAGAACAGCCGTGGG
PCR product length 159 bp
PCR conditions 95 °C15 sec64 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp