Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK04208 |
---|---|
Accession No | AB011138 |
Description | ATPase, class V, type 10A |
Clone name | hh01910 |
Vector information | |
cDNA sequence | DNA sequence (5562 bp) Predicted protein sequence (1163 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA0566
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | Warning |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR001757 | 89 | 103 | PR00119 | ATPase |
IPR001757 | 693 | 712 | PR00119 | ATPase | |
HMMPfam | IPR013200 | 687 | 710 | PF08282 | HAD superfamily hydrolase-like |
HMMTigr | IPR006539 | 3 | 973 | TIGR01652 | Phospholipid-translocating P-type ATPase |
IPR001757 | 521 | 570 | TIGR01494 | ATPase | |
IPR001757 | 662 | 773 | TIGR01494 | ATPase | |
ScanRegExp | IPR001757 | 91 | 97 | PS00154 | ATPase |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 24 | YSFLTMIIVLQVLIPISLYVSIE | 46 | PRIMARY | 23 | 2 | 772 | FFCGFSASTMIDQWYLIFFNLLF | 794 | PRIMARY | 23 | 3 | 836 | WFNMADAAFQSLVCFSIPYLAYY | 858 | SECONDARY | 23 | 4 | 865 | FTWGTPIVTIALLTFLLHLGIET | 887 | PRIMARY | 23 | 5 | 895 | WITCGFSVLLFFTVALIYNASCA | 917 | SECONDARY | 23 | 6 | 930 | QALLGDPVFYLTCLMTPVAALLP | 952 | SECONDARY | 23 |
---|
RT-PCR |
---|
Primer_f | TTTCCATAATACTCCCCATCC |
---|---|
Primer_r | CTCTTGGGAAACGGAATGACC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TTTCCATAATACTCCCCATCC |
Primer_r | CTCTTGGGAAACGGAATGACC |
PCR product length | 124 bp |
PCR conditions | 95 °C15 sec64 °C60 sec30 cycles |