Order Kazusa clone(s) from : ![]() |
Product ID | ORK04209 |
---|---|
Accession No | AB040920 |
Description | ATPase, class V, type 10D |
Clone name | fj07249 |
Vector information | |
cDNA sequence | DNA sequence (3992 bp) Predicted protein sequence (650 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA1487
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 2037 bp |
---|---|
Genome contig ID | gi89161207f_47154940 |
PolyA signal sequence (AATATA,-17) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (135254 - 135303) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 4 | f | 47254940 | 47290192 | 12 | 99.4 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR013200 | 274 | 295 | PF08282 | HAD superfamily hydrolase-like |
HMMTigr | IPR001757 | 111 | 161 | TIGR01494 | ATPase |
IPR001757 | 251 | 358 | TIGR01494 | ATPase |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 333 | RLSNMILYFFYKNVAYVNLLFWY | 355 | SECONDARY | 23 | 2 | 372 | LIFFNLLFTSAPPVIYGVLEKDV | 394 | SECONDARY | 23 | 3 | 418 | HTFWITLLDAFYQSLVCFFVPYF | 440 | SECONDARY | 23 | 4 | 456 | LNTAALFIVLLHLVIESKSLTWI | 478 | PRIMARY | 23 | 5 | 482 | VIIGSILSYFLFAIVFGAMCVT | 503 | PRIMARY | 22 | 6 | 518 | MLDPVFYLVCILTTSIALLPRFV | 540 | PRIMARY | 23 |
---|
![]() |
Primer_f | CATGTATGCTGGCTTTAGTTG |
---|---|
Primer_r | GAGCATGGAGATTCAGGAAGG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |