Order Kazusa clone(s) from : ![]() |
Product ID | ORK04226 |
---|---|
Accession No | AB032963 |
Description | ATPase, aminophospholipid transporter, class I, type 8B, member 2 |
Clone name | hj03907 |
Vector information | |
cDNA sequence | DNA sequence (4990 bp) Predicted protein sequence (933 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA1137
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 2186 bp |
---|---|
Genome contig ID | gi89161185f_152473624 |
PolyA signal sequence (TATAAA,-21) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (116783 - 116832) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 1 | f | 152573624 | 152590405 | 18 | 99.4 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR001757 | 133 | 147 | PR00119 | ATPase |
IPR001757 | 555 | 574 | PR00119 | ATPase | |
HMMTigr | IPR006539 | 1 | 844 | TIGR01652 | Phospholipid-translocating P-type ATPase |
IPR001757 | 63 | 154 | TIGR01494 | ATPase | |
IPR001757 | 385 | 434 | TIGR01494 | ATPase | |
IPR001757 | 520 | 635 | TIGR01494 | ATPase | |
ScanRegExp | IPR001757 | 135 | 141 | PS00154 | ATPase |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 16 | MNTLVLWIFGFLVCMGVILAIGN | 38 | PRIMARY | 23 | 2 | 65 | SGFLSFWSYIIILNTVVPISLYV | 87 | PRIMARY | 23 | 3 | 617 | YFFYKNFAFTMVHFWFGFFCGFS | 639 | SECONDARY | 23 | 4 | 649 | ITLYNIVYTSLPVLAMGVFDQDV | 671 | SECONDARY | 23 | 5 | 698 | FICIAQGIYTSVLMFFIPYGVFA | 720 | SECONDARY | 23 | 6 | 733 | YQSFAVTVATSLVIVVSVQIGLD | 755 | PRIMARY | 23 | 7 | 761 | AINHFFIWGSLAVYFAILFAMHS | 783 | SECONDARY | 23 | 8 | 808 | TVWLTIVLTTVVCIMPVVAFRFL | 830 | PRIMARY | 23 |
---|
![]() |
Primer_f | AGCATCTATGAGGAGGTTGAG |
---|---|
Primer_r | AAACCTCAGTCATGTCATCCG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |