Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK04227 |
---|---|
Accession No | AB075819 |
Description | ATPase, class I, type 8B, member 4 |
Clone name | ah01164 |
Vector information | |
cDNA sequence | DNA sequence (5782 bp) Predicted protein sequence (1082 aa) |
Source | Human brain (amygdala) |
Rouge ID |
mKIAA1939
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | Warning |
Length of 3'UTR | 1954 bp |
---|---|
Genome contig ID | gi51511731r_47837728 |
PolyA signal sequence (AGTAAA,-24) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 15 | r | 47937728 | 48192805 | 29 | 99.5 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR001757 | 280 | 294 | PR00119 | ATPase |
IPR001757 | 703 | 722 | PR00119 | ATPase | |
HMMPfam | IPR013200 | 700 | 720 | PF08282 | HAD superfamily hydrolase-like |
HMMTigr | IPR006539 | 2 | 992 | TIGR01652 | Phospholipid-translocating P-type ATPase |
IPR001757 | 208 | 302 | TIGR01494 | ATPase | |
IPR001757 | 532 | 581 | TIGR01494 | ATPase | |
IPR001757 | 676 | 783 | TIGR01494 | ATPase | |
ScanRegExp | IPR001757 | 282 | 288 | PS00154 | ATPase |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 163 | MNTLVLWIFGFLICLGIILAIGN | 185 | PRIMARY | 23 | 2 | 214 | FLTFWSYIIILNTVVPISLYVSV | 236 | PRIMARY | 23 | 3 | 771 | FAFTLVHFWFGFFCGFSAQTVYD | 793 | SECONDARY | 23 | 4 | 797 | ITLFNIVYTSLPVLAMGIFDQDV | 819 | SECONDARY | 23 | 5 | 845 | FFICVLHGIYTSLVLFFIPYGAF | 867 | PRIMARY | 23 | 6 | 881 | YQSFAVTMATSLVIVVSVQIALD | 903 | PRIMARY | 23 | 7 | 908 | TFINHVFIWGSIAIYFSILFTMH | 930 | PRIMARY | 23 | 8 | 952 | LTQKCIWLVILLTTVASVMPVVA | 974 | PRIMARY | 23 |
---|
RT-PCR-ELISA |
Primer_f | GTGCAGATAGCCTTGGATACC |
---|---|
Primer_r | AGAGAATTACAAGCCAGATGC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | genbank |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |