Order Kazusa clone(s) from : 
Japan
||
Other countries |
|
Order Kazusa clone(s) from :
Japan
||
Other countries |
| Product ID | ORK04531 |
|---|---|
| Accession No | AB011152 |
| Description | ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2 |
| Clone name | hj00601s1 |
| Vector information |
The cDNA fragment was inserted at the SalI-NotI site of the ...
|
| cDNA sequence | DNA sequence (6802 bp) Predicted protein sequence (1631 aa) |
| Source | Human adult brain |
| Rouge ID |
mKIAA0580
by Kazusa Mouse cDNA Project
|
| Note | We replaced hj00601, former representative clones for KIAA0580 with hj00601s1. (2003/4/2) |
Length: 6802 bp Physical map
Restriction map Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | Warning | No warning |
Integrity of 3' end
| Length of 3'UTR | 1906 bp |
|---|---|
| Genome contig ID | gi89161207r_35644017 |
| PolyA signal sequence (ATTAAA,-27) |
+----*----+----*----+----*----+---- |
| Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
| Chr | f/r | start | end | exon | identity | class | |
|---|---|---|---|---|---|---|---|
|
| 4 | r | 35744017 | 35907284 | 32 | 99.6 | Perfect prediction |
Length: 1631 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment) |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database
(FASTA output,
Multiple alignment) |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI) Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| FPrintScan | IPR001164 | 624 | 643 | PR00405 | Arf GTPase activating protein |
| IPR001164 | 643 | 660 | PR00405 | Arf GTPase activating protein | |
| HMMPfam | IPR001849 | 410 | 501 | PF00169 | Pleckstrin-like |
| IPR001849 | 515 | 606 | PF00169 | Pleckstrin-like | |
| IPR001164 | 612 | 734 | PF01412 | Arf GTPase activating protein | |
| IPR001849 | 820 | 930 | PF00169 | Pleckstrin-like | |
| IPR000198 | 1056 | 1209 | PF00620 | RhoGAP | |
| IPR000159 | 1253 | 1347 | PF00788 | Ras-association | |
| IPR001849 | 1362 | 1464 | PF00169 | Pleckstrin-like | |
| HMMSmart | IPR001849 | 410 | 503 | SM00233 | Pleckstrin-like |
| IPR001849 | 515 | 608 | SM00233 | Pleckstrin-like | |
| IPR001164 | 613 | 734 | SM00105 | Arf GTPase activating protein | |
| IPR001849 | 820 | 932 | SM00233 | Pleckstrin-like | |
| IPR001849 | 942 | 1041 | SM00233 | Pleckstrin-like | |
| IPR000198 | 1053 | 1229 | SM00324 | RhoGAP | |
| IPR001849 | 1362 | 1466 | SM00233 | Pleckstrin-like | |
| ProfileScan | IPR001849 | 409 | 501 | PS50003 | Pleckstrin-like |
| IPR001849 | 514 | 606 | PS50003 | Pleckstrin-like | |
| IPR001164 | 603 | 738 | PS50115 | Arf GTPase activating protein | |
| IPR001849 | 805 | 930 | PS50003 | Pleckstrin-like | |
| IPR000198 | 1043 | 1224 | PS50238 | RhoGAP | |
| IPR000159 | 1253 | 1347 | PS50200 | Ras-association | |
| IPR001849 | 1361 | 1464 | PS50003 | Pleckstrin-like |
|
RT-PCR
|
|---|
Experimental conditions| Primer_f | GGACAGTGGAAAAGTATCTAG |
|---|---|
| Primer_r | GTCATCATTAGCCCTTATCTC |
| PCR conditions | 95 °C 30 sec55 °C30 sec72 °C60 sec30 cycles |
Chromosome No. 4 Experimental conditions| Panel name | GeneBridge 4 |
|---|---|
| Primer_f | GGACAGTGGAAAAGTATCTAG |
| Primer_r | GTCATCATTAGCCCTTATCTC |
| PCR product length | 146 bp |
| PCR conditions | 95 °C15 sec62 °C60 sec30 cycles |
Japan
||
Other countries
