KIAA0693

Product ID	ORK00607
Accession No	AB014593
Description	synovial sarcoma translocation gene on chromosome 18-like 1, transcript variant 1
Clone name	hk03927
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4493 bp) Predicted protein sequence (404 aa)
HaloTag ORF Clone	FHC00607
Flexi ORF Clone	FXC00607
Source	Human adult brain
Rouge ID	mKIAA0693 by Kazusa Mouse cDNA Project

Length: 4493 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3276 bp
Genome contig ID	gi51511747f_60052246
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- GTGTAATCTCTTAATAAACTGGTTCTTCAAAAATC
Flanking genome sequence (138691 - 138740)	----+--------+--------+--------+--------+----* ATCCTATAAAGTGAGTTTTCATGAAGTTAACGGGATTTTGGTGTGATGTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	20	f	60152246	60190935	11	100.0	Perfect prediction

Length: 404 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
O75177	2.2e-128	100.0	SS18-like prote...	Homo sapiens
BAF84174	3.2e-128	99.7	unnamed protein...	Homo sapiens
ABM81834	4e-128	99.7	synovial sarcom...	synthetic construct
BAG61729	1.6e-125	99.2	unnamed protein...	Homo sapiens
EAW75391	4.1e-121	100.0	synovial sarcom...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	NULL	9	76	PD020165	NULL
HMMPfam	IPR007726	19	84	PF05030	SSXT
ScanRegExp	IPR000532	108	130	PS00260	Glucagon/GIP/secretin/VIP

Primer_f	TGAAGTGTGGTTGATGGTGCT
Primer_r	ATAGGAAGAAGAATGAGCGTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TGAAGTGTGGTTGATGGTGCT
Primer_r	ATAGGAAGAAGAATGAGCGTC
PCR product length	104 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles