KIAA0772

Product ID	ORK01994
Accession No	AB018315
Description	oxysterol binding protein-like 2, transcript variant 1
Clone name	hk05119
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3879 bp) Predicted protein sequence (469 aa)
HaloTag ORF Clone	FHC01994
Flexi ORF Clone	FXC01994
Source	Human adult brain
Rouge ID	mKIAA0772 by Kazusa Mouse cDNA Project

Length: 3879 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2325 bp
Genome contig ID	gi51511747f_60164506
PolyA signal sequence (None)	+--------+--------+----*----+---- CTTAATGTGTGGAAAGTGATGGCCTTCTCGTGGGC
Flanking genome sequence (140160 - 140209)	----+--------+--------+--------+--------+----* CACGCGTTTGGGTGTGAGTATGGCCTTGACCAAGGGTCTTGGTGCTTTAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	20	f	60247030	60304664	14	99.4	Perfect prediction

Length: 469 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
CAC22307	2.9e-208	100.0	oxysterol bindi...	Homo sapiens
XP_001144165	7.3e-208	99.8	oxysterol-bindi...	Pan troglodytes
Q9H1P3	4.3e-203	97.5	Oxysterol-bindi...	Homo sapiens
XP_001144248	1.1e-202	97.3	oxysterol-bindi...	Pan troglodytes
BAG37950	7e-202	97.3	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB014604	1.5e-39	38.4	KIAA0704
AB051451	4.6e-35	36.9	KIAA1664
AB040884	9e-21	26.9	KIAA1451
AB040967	7.3e-19	28.5	KIAA1534

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000648	24	461	PF01237	Oxysterol-binding protein
ScanRegExp	IPR000648	163	173	PS01013	Oxysterol-binding protein

Primer_f	TTCAGGATTGTGGCGTTATTC
Primer_r	TCTCACCTCTGGATGTTCTAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TTCAGGATTGTGGCGTTATTC
Primer_r	TCTCACCTCTGGATGTTCTAG
PCR product length	165 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles