Order Kazusa clone(s) from : ![]() |
Product ID | ORK00230 |
---|---|
Accession No | AB040884 |
Description | oxysterol binding protein-like 8, transcript variant 1 |
Clone name | bg00289 |
Vector information | |
cDNA sequence | DNA sequence (6928 bp) Predicted protein sequence (939 aa) |
HaloTag ORF Clone |
FHC00230
![]() |
Flexi ORF Clone | FXC00230 |
Source | Human adult brain |
Rouge ID |
mKIAA1451
by Kazusa Mouse cDNA Project
|
Note | We replaced fh12482, former representative clones for KIAA1451 with bg00289. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 4107 bp |
---|---|
Genome contig ID | gi89161190r_75169711 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (54430 - 54381) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 12 | r | 75224141 | 75477391 | 25 | 99.4 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001849 | 199 | 315 | PF00169 | Pleckstrin-like |
IPR000648 | 425 | 835 | PF01237 | Oxysterol-binding protein | |
HMMSmart | IPR001849 | 199 | 317 | SM00233 | Pleckstrin-like |
ProfileScan | IPR001849 | 198 | 315 | PS50003 | Pleckstrin-like |
ScanRegExp | IPR000648 | 560 | 570 | PS01013 | Oxysterol-binding protein |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 918 | QKDYFIIFLLILLQVIINFMFK | 939 | PRIMARY | 22 |
---|
![]() |
Primer_f | TAATCCTATACTTGGCGAGAC |
---|---|
Primer_r | ACTTAGACTTAGCCAGGATAC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CTTCACACATGGACCGTAAAC |
Primer_r | TACTAAATGGTGGATGATGGC |
PCR product length | 200 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |