KIAA1451

Product ID	ORK00230
Accession No	AB040884
Description	oxysterol binding protein-like 8, transcript variant 1
Clone name	bg00289
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector(Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGC TGAAGCTTTC ACAAGTTTGT ACAAAAAAGC AGGCTCTTC-5' end of cDNA, GAGCTCTCAC CACTTTGTAC AAGAAAGCTG GGCGGCCGCT TTTTTTTTTT TTTTTTT-3' end of cDNA).
cDNA sequence	DNA sequence (6928 bp) Predicted protein sequence (939 aa)
HaloTag ORF Clone	FHC00230
Flexi ORF Clone	FXC00230
Source	Human adult brain
Rouge ID	mKIAA1451 by Kazusa Mouse cDNA Project
Note	We replaced fh12482, former representative clones for KIAA1451 with bg00289. (2002/5/10)

Length: 6928 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	4107 bp
Genome contig ID	gi89161190r_75169711
PolyA signal sequence (None)	+--------+--------+----*----+---- AATTTTTAAAAAGAGCAAAAAAAAAAAAAAAAAAA
Flanking genome sequence (54430 - 54381)	----+--------+--------+--------+--------+----* AAAGACTCAAGTCCTTATCCTACATACTGTGGAAAGTTCAGTGCCTTTCC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	12	r	75224141	75477391	25	99.4	Perfect prediction

Length: 939 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_509228	99.9	oxysterol-bindi...	Pan troglodytes
XP_001082052	99.1	similar to oxys...	Macaca mulatta
Q9BZF1	100.0	Oxysterol-bindi...	Homo sapiens
CAI46050	99.8	hypothetical pr...	Homo sapiens
CAH91148	99.7	hypothetical pr...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040967	6e-87	55.6	KIAA1534
AB018315	9.6e-16	26.9	KIAA0772
AB014604	2.6e-10	23.8	KIAA0704
AB051451	3.6e-10	25.3	KIAA1664

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001849	199	315	PF00169	Pleckstrin-like
HMMPfam	IPR000648	425	835	PF01237	Oxysterol-binding protein
HMMSmart	IPR001849	199	317	SM00233	Pleckstrin-like
ProfileScan	IPR001849	198	315	PS50003	Pleckstrin-like
ScanRegExp	IPR000648	560	570	PS01013	Oxysterol-binding protein

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	918	QKDYFIIFLLILLQVIINFMFK	939	PRIMARY	22

Primer_f	TAATCCTATACTTGGCGAGAC
Primer_r	ACTTAGACTTAGCCAGGATAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CTTCACACATGGACCGTAAAC
Primer_r	TACTAAATGGTGGATGATGGC
PCR product length	200 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles