KIAA1664

Product ID	ORK00262
Accession No	AB051451
Description	oxysterol binding protein 2, transcript variant 1
Clone name	fj04751s1
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4244 bp) Predicted protein sequence (920 aa)
HaloTag ORF Clone	FHC00262
Flexi ORF Clone	FXC00262
Source	Human fetal brain
Note	We replaced fj04751, former representative clones for KIAA1664 with fj04751s1. (2005/08/06)

Length: 4244 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	1481 bp
Genome contig ID	gi89161203f_29320885
PolyA signal sequence (AATAAA,-29)	+--------+--------+----*----+---- ACCAGTAATAAAAAACCTTGGCTTTGGAGTTTTCC
Flanking genome sequence (312924 - 312973)	----+--------+--------+--------+--------+----* ACTGCCCTGTCCCTCAGTCTCTGTGTATCTGGGTGGAGGGGACTAATGTA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	22	f	29420885	29633807	14	99.8	Perfect prediction

Length: 920 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG10478	100.0	oxysterol-bindi...	synthetic construct
Q969R2	99.9	Oxysterol-bindi...	Homo sapiens
AAI18915	99.8	Oxysterol bindi...	Homo sapiens
AAK56864	100.0	oxysterol bindi...	Homo sapiens
XP_525565	93.6	oxysterol bindi...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB014604	2.1e-19	33.5	KIAA0704
AB018315	3.9e-18	36.9	KIAA0772
AB040967	3.2e-07	27.4	KIAA1534
AB040884	3e-06	25.3	KIAA1451

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001849	187	278	PF00169	Pleckstrin-like
HMMPfam	IPR000648	488	910	PF01237	Oxysterol-binding protein
HMMSmart	IPR001849	187	280	SM00233	Pleckstrin-like
ProfileScan	IPR001849	186	278	PS50003	Pleckstrin-like
ScanRegExp	IPR000648	626	636	PS01013	Oxysterol-binding protein

Primer_f
Primer_r
PCR conditions	test

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-