KIAA0842

Product ID	ORK01609
Accession No	AB020649
Description	pleckstrin homology domain containing, family M (with RUN domain) member 2
Clone name	hk05077
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3896 bp) Predicted protein sequence (1020 aa)
HaloTag ORF Clone	FHC01609
Flexi ORF Clone	FXC01609
Source	Human adult brain
Rouge ID	mKIAA0842 by Kazusa Mouse cDNA Project

Length: 3896 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	833 bp
Genome contig ID	gi89161185f_15783638
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- TGTTTTTTAAAATAAAATAGACATGTTATATTGCC
Flanking genome sequence (150213 - 150262)	----+--------+--------+--------+--------+----* AAGGCTTGTCACTGGCCCTTTTTGAGCAGGGTAGGGGAAGGGAGCTCTCC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	f	15883638	15933849	20	100.0	Perfect prediction

Length: 1020 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAH40441	100.0	PLEKHM2 protein...	Homo sapiens
Q8IWE5	100.0	Pleckstrin homo...	Homo sapiens
XP_513054	99.4	pleckstrin homo...	Pan troglodytes
XP_001089676	99.2	similar to plec...	Macaca mulatta
XP_593587	90.3	pleckstrin homo...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004012	45	159	PF02759	RUN
HMMPfam	IPR001849	773	874	PF00169	Pleckstrin-like
HMMSmart	IPR004012	94	157	SM00593	RUN
HMMSmart	IPR001849	773	876	SM00233	Pleckstrin-like
ProfileScan	IPR004012	37	159	PS50826	RUN
ProfileScan	IPR001849	772	874	PS50003	Pleckstrin-like
ScanRegExp	IPR002086	820	831	PS00070	Aldehyde dehydrogenase

Primer_f	TGTAGCACCGAGGAGCAAAGG
Primer_r	GGCTCTTGACGAAACTCTAGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TGTAGCACCGAGGAGCAAAGG
Primer_r	GGCTCTTGACGAAACTCTAGG
PCR product length	140 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles