Order Kazusa clone(s) from : ![]() |
Product ID | ORK01609 |
---|---|
Accession No | AB020649 |
Description | pleckstrin homology domain containing, family M (with RUN domain) member 2 |
Clone name | hk05077 |
Vector information | |
cDNA sequence | DNA sequence (3896 bp) Predicted protein sequence (1020 aa) |
HaloTag ORF Clone |
FHC01609
![]() |
Flexi ORF Clone | FXC01609 |
Source | Human adult brain |
Rouge ID |
mKIAA0842
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 833 bp |
---|---|
Genome contig ID | gi89161185f_15783638 |
PolyA signal sequence (AATAAA,-25) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (150213 - 150262) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 1 | f | 15883638 | 15933849 | 20 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR004012 | 45 | 159 | PF02759 | RUN |
IPR001849 | 773 | 874 | PF00169 | Pleckstrin-like | |
HMMSmart | IPR004012 | 94 | 157 | SM00593 | RUN |
IPR001849 | 773 | 876 | SM00233 | Pleckstrin-like | |
ProfileScan | IPR004012 | 37 | 159 | PS50826 | RUN |
IPR001849 | 772 | 874 | PS50003 | Pleckstrin-like | |
ScanRegExp | IPR002086 | 820 | 831 | PS00070 | Aldehyde dehydrogenase |
![]() |
Primer_f | TGTAGCACCGAGGAGCAAAGG |
---|---|
Primer_r | GGCTCTTGACGAAACTCTAGG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TGTAGCACCGAGGAGCAAAGG |
Primer_r | GGCTCTTGACGAAACTCTAGG |
PCR product length | 140 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |