Gene/Protein Characteristic Table for KIAA1295
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK06818
Accession No AB037716
Description SH3 and PX domains 2B
Clone name fg01760
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (6524 bp)
Predicted protein sequence (550 aa)
Source Human fetal brain
Rouge ID mKIAA1295 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 6524 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning Warning
Integrity of 3' end
Length of 3'UTR 4870 bp
Genome contig ID gi51511721r_171593163
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
AAAAAAGTGCTTGACTGGTTTCAAGCTTCATCATG
Flanking genome sequence
(99947 - 99898)
----+----*----+----*----+----*----+----*----+----*
AAGATGCAGTGTCTATGGATTTTATTTGGCAGGAGAAAGGGTACATAGCT

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 5 r 171693110 171705850 2 99.0 Perfect prediction
Features of the protein sequence
Description

Length: 550 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
EAW61434 2.9e-174 100.0 SH3 and PX doma...
Homo sapiens
EAW61433 2.9e-174 100.0 SH3 and PX doma...
Homo sapiens
AAI56243 3.2e-174 100.0 SH3 and PX doma...
synthetic construct
A1X283 3.2e-174 100.0 SH3 and PX doma...
Homo sapiens
AAZ99795 9.7e-174 99.8 adaptor protein...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB007878 4e-06 27.5 KIAA0418
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR001452 24 61 PD000066 Src homology-3
IPR001452 494 546 PD000066 Src homology-3
FPrintScan IPR001452 492 502 PR00452 Src homology-3
IPR001452 505 520 PR00452 Src homology-3
IPR001452 537 549 PR00452 Src homology-3
HMMPfam IPR001452 10 64 PF00018 Src homology-3
IPR001452 508 549 PF00018 Src homology-3
HMMSmart IPR001452 10 65 SM00326 Src homology-3
IPR001452 492 550 SM00326 Src homology-3
ProfileScan IPR001452 7 66 PS50002 Src homology-3
IPR001452 508 550 PS50002 Src homology-3
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f AGGAGTGGACAGTCTGGTATT
Primer_r ATGTAAGACTTGGGCACGATG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 5
Experimental conditions
Panel name unigene
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp