KIAA1295

Product ID	ORK06818
Accession No	AB037716
Description	SH3 and PX domains 2B
Clone name	fg01760
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6524 bp) Predicted protein sequence (550 aa)
Source	Human fetal brain
Rouge ID	mKIAA1295 by Kazusa Mouse cDNA Project

Length: 6524 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	4870 bp
Genome contig ID	gi51511721r_171593163
PolyA signal sequence (None)	+--------+--------+----*----+---- AAAAAAGTGCTTGACTGGTTTCAAGCTTCATCATG
Flanking genome sequence (99947 - 99898)	----+--------+--------+--------+--------+----* AAGATGCAGTGTCTATGGATTTTATTTGGCAGGAGAAAGGGTACATAGCT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	5	r	171693110	171705850	2	99.0	Perfect prediction

Length: 550 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW61434	2.9e-174	100.0	SH3 and PX doma...	Homo sapiens
EAW61433	2.9e-174	100.0	SH3 and PX doma...	Homo sapiens
AAI56243	3.2e-174	100.0	SH3 and PX doma...	synthetic construct
A1X283	3.2e-174	100.0	SH3 and PX doma...	Homo sapiens
AAZ99795	9.7e-174	99.8	adaptor protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB007878	4e-06	27.5	KIAA0418

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001452	24	61	PD000066	Src homology-3
BlastProDom	IPR001452	494	546	PD000066	Src homology-3
FPrintScan	IPR001452	492	502	PR00452	Src homology-3
	IPR001452	505	520	PR00452	Src homology-3
	IPR001452	537	549	PR00452	Src homology-3
HMMPfam	IPR001452	10	64	PF00018	Src homology-3
HMMPfam	IPR001452	508	549	PF00018	Src homology-3
HMMSmart	IPR001452	10	65	SM00326	Src homology-3
HMMSmart	IPR001452	492	550	SM00326	Src homology-3
ProfileScan	IPR001452	7	66	PS50002	Src homology-3
ProfileScan	IPR001452	508	550	PS50002	Src homology-3

Primer_f	AGGAGTGGACAGTCTGGTATT
Primer_r	ATGTAAGACTTGGGCACGATG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-