Order Kazusa clone(s) from : ![]() |
Product ID | ORK02053 |
---|---|
Accession No | AB053448 |
Description | cadherin-related family member 1, transcript variant 1 |
Clone name | hk03826 |
Vector information | |
cDNA sequence | DNA sequence (4483 bp) Predicted protein sequence (858 aa) |
HaloTag ORF Clone |
FHC02053
![]() |
Flexi ORF Clone | FXC02053 |
Source | Human adult brain |
Rouge ID |
mKIAA1775
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 1904 bp |
---|---|
Genome contig ID | gi89161187f_85844498 |
PolyA signal sequence (AATAAA,-23) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (121765 - 121814) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 10 | f | 85944498 | 85966261 | 17 | 99.4 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR002126 | 78 | 97 | PR00205 | Cadherin |
IPR002126 | 134 | 163 | PR00205 | Cadherin | |
IPR002126 | 204 | 216 | PR00205 | Cadherin | |
IPR002126 | 224 | 243 | PR00205 | Cadherin | |
IPR002126 | 243 | 256 | PR00205 | Cadherin | |
IPR002126 | 418 | 444 | PR00205 | Cadherin | |
IPR002126 | 453 | 470 | PR00205 | Cadherin | |
HMMPfam | IPR002126 | 39 | 112 | PF00028 | Cadherin |
IPR002126 | 139 | 236 | PF00028 | Cadherin | |
IPR002126 | 250 | 343 | PF00028 | Cadherin | |
IPR002126 | 362 | 462 | PF00028 | Cadherin | |
IPR002126 | 476 | 566 | PF00028 | Cadherin | |
IPR002126 | 577 | 676 | PF00028 | Cadherin | |
HMMSmart | IPR002126 | 56 | 132 | SM00112 | Cadherin |
IPR002126 | 156 | 243 | SM00112 | Cadherin | |
IPR002126 | 267 | 350 | SM00112 | Cadherin | |
IPR002126 | 381 | 469 | SM00112 | Cadherin | |
IPR002126 | 493 | 573 | SM00112 | Cadherin | |
IPR002126 | 592 | 683 | SM00112 | Cadherin | |
ProfileScan | IPR002126 | 41 | 134 | PS50268 | Cadherin |
IPR002126 | 135 | 245 | PS50268 | Cadherin | |
IPR002126 | 246 | 352 | PS50268 | Cadherin | |
IPR002126 | 358 | 471 | PS50268 | Cadherin | |
IPR002126 | 472 | 575 | PS50268 | Cadherin | |
IPR002126 | 587 | 687 | PS50268 | Cadherin | |
ScanRegExp | IPR002126 | 459 | 469 | PS00232 | Cadherin |
IPR002126 | 563 | 573 | PS00232 | Cadherin |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 4 | RWAALALGLLRLCLAQANFAPHF | 26 | SECONDARY | 23 | 2 | 700 | AVGVLAGTMATVVAITVLISTAT | 722 | PRIMARY | 23 |
---|
![]() |
Primer_f | TACAGTCCCCAACGTGAACAG |
---|---|
Primer_r | AAGCATGATCCAGCACAGTCC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TACAGTCCCCAACGTGAACAG |
Primer_r | AAGCATGATCCAGCACAGTCC |
PCR product length | 122 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |