KIAA1790

Product ID	ORK05884
Accession No	AB058693
Description	leucine-rich repeat kinase 1
Clone name	fh24104
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5370 bp) Predicted protein sequence (1369 aa)
Source	Human fetal brain
Rouge ID	mKIAA1790 by Kazusa Mouse cDNA Project

Length: 5370 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1258 bp
Genome contig ID	gi51511731f_99280195
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- CTCTTTTAATCTCAAAATAAACAGATTCTTTCAAG
Flanking genome sequence (147641 - 147690)	----+--------+--------+--------+--------+----* AACGAAGCTGTGGCCTCTGTCTTTTGAGCGCTTATGACCACAGCACGGGC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	15	f	99380195	99427834	20	99.6	Perfect prediction

Length: 1369 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAX02287	99.9	leucine-rich re...	Homo sapiens
AAY67799	99.9	leucine-rich re...	Homo sapiens
NP_078928	99.9	leucine-rich re...	Homo sapiens
Q38SD2	99.9	Leucine-rich re...	Homo sapiens
EAX02289	99.9	leucine-rich re...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB082526	6e-07	27.8	KIAA1995
AB051547	6.9e-07	30.1	KIAA1760
AB058763	1.6e-06	32.6	KIAA1860
AB002342	3.2e-06	23.6	KIAA0344
AB018330	3.2e-06	24.9	KIAA0787

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	651	865	PD000001	Protein kinase
HMMPfam	IPR013684	1	114	PF08477	Miro-like
HMMPfam	IPR000719	596	874	PF00069	Protein kinase
HMMSmart	IPR001245	596	874	SM00219	Tyrosine protein kinase
HMMSmart	IPR002290	596	879	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	596	879	PS50011	Protein kinase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	969	NTPQQALDTPAVVTCFLAVPVI	990	SECONDARY	22
SOSUI2	2	994	SYLVLAGLADGLVAVFPVVRGTP	1016	PRIMARY	23

Primer_f	CTACCTCAGTGTGGAATCTTC
Primer_r	GCGGGAAACCACTGATCAATC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-