KIAA1900

Product ID	ORK05769
Accession No	AB067487
Description	kelch-like family member 32
Clone name	fk07650
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3221 bp) Predicted protein sequence (582 aa)
Source	Human fetal brain
Rouge ID	mKIAA1900 by Kazusa Mouse cDNA Project

Length: 3221 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1472 bp
Genome contig ID	gi89161210f_97430685
PolyA signal sequence (AATAAA,-27)	+--------+--------+----*----+---- CAAAAGTGAATAAAAACGATCTTTTTGTCTTACAG
Flanking genome sequence (264668 - 264717)	----+--------+--------+--------+--------+----* AATTCACTAACTTCATATATCGTTATACACAAAACATTGAAAATACATAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	6	f	97530685	97695351	9	100.0	Perfect prediction

Length: 582 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_518646	99.7	similar to RP1-...	Pan troglodytes
BAB70899	99.8	unnamed protein...	Homo sapiens
XP_001503889	98.6	kelch-like 32 (...	Equus caballus
XP_872392	98.3	similar to Kelc...	Bos taurus
CAM14812	98.5	kelch-like 32 (...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037805	1.3e-33	28.7	KIAA1384
AB037775	6e-26	36.8	KIAA1354
AB037730	1.5e-24	36.7	KIAA1309
AB067508	1.7e-21	24.7	KIAA1921
AB032955	2.1e-21	28.5	KIAA1129

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013069	2	101	PF00651	BTB/POZ
	IPR011705	106	207	PF07707	BTB/Kelch-associated
	IPR006652	297	347	PF01344	Kelch repeat type 1
	IPR006652	349	395	PF01344	Kelch repeat type 1
	IPR006652	397	443	PF01344	Kelch repeat type 1
	IPR006652	445	495	PF01344	Kelch repeat type 1
	IPR006652	503	548	PF01344	Kelch repeat type 1
HMMSmart	IPR000210	4	101	SM00225	BTB/POZ-like
	IPR006652	252	308	SM00612	Kelch repeat type 1
	IPR006652	309	360	SM00612	Kelch repeat type 1
	IPR006652	361	408	SM00612	Kelch repeat type 1
	IPR006652	409	456	SM00612	Kelch repeat type 1
	IPR006652	457	509	SM00612	Kelch repeat type 1
ProfileScan	IPR000210	4	71	PS50097	BTB/POZ-like

Primer_f	TGCTGGATATGTGGCTGATGG
Primer_r	GATCCGGTCATTATTGTAGTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-