KIAA1921

Product ID	ORK05768
Accession No	AB067508
Description	kelch-like family member 29
Clone name	fg00938
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6385 bp) Predicted protein sequence (545 aa)
Source	Human fetal brain
Rouge ID	mKIAA1921 by Kazusa Mouse cDNA Project

Length: 6385 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	Warning

Integrity of 3' end

Length of 3'UTR	1947 bp
Genome contig ID	gi89161199f_23665160
PolyA signal sequence (AATAAA,-29)	+--------+--------+----*----+---- TATTATAATAAATATATTTATAGATCTAGACTTGG
Flanking genome sequence (119827 - 119876)	----+--------+--------+--------+--------+----* AAGCCAACGTAATCTTTGTGTGCCATCGTCCTGCCACAGGGATGCAAAAC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	f	23765160	23784985	8	99.1	Perfect prediction

Length: 545 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q96CT2	99.6	Kelch-like prot...	Homo sapiens
AAH13982	99.6	KLHL29 protein ...	Homo sapiens
EAX00787	99.6	hCG1783917, iso...	Homo sapiens
EAX00791	99.6	hCG1783917, iso...	Homo sapiens
EAX00793	99.6	hCG1783917, iso...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB032955	8.4e-53	31.5	KIAA1129
AB018338	1.3e-45	32.1	KIAA0795
AB037799	2.4e-39	29.2	KIAA1378
AB007938	3.2e-37	34.6	KIAA0469
AB040923	4.4e-37	29.6	KIAA1490

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013069	26	101	PF00651	BTB/POZ
	IPR011705	106	208	PF07707	BTB/Kelch-associated
	IPR011498	243	292	PF07646	Kelch repeat type 2
	IPR006652	295	340	PF01344	Kelch repeat type 1
	IPR006652	342	387	PF01344	Kelch repeat type 1
	IPR006652	389	435	PF01344	Kelch repeat type 1
	IPR006652	480	527	PF01344	Kelch repeat type 1
HMMSmart	IPR006652	255	306	SM00612	Kelch repeat type 1
	IPR006652	307	353	SM00612	Kelch repeat type 1
	IPR006652	354	400	SM00612	Kelch repeat type 1
	IPR006652	401	448	SM00612	Kelch repeat type 1
	IPR006652	449	491	SM00612	Kelch repeat type 1
	IPR006652	492	540	SM00612	Kelch repeat type 1

Primer_f	GCGCTGTTGAGTTGAAGTTGG
Primer_r	TCGTAGTGCTAGAAGTTGATG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-