KIAA1129

Product ID	ORK00744
Accession No	AB032955
Description	kelch-like family member 3, transcript variant 1
Clone name	hg04330
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6573 bp) Predicted protein sequence (625 aa)
HaloTag ORF Clone	FHC00744
Flexi ORF Clone	FXC00744
Source	Human adult brain

Length: 6573 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	Warning

Integrity of 3' end

Length of 3'UTR	4595 bp
Genome contig ID	gi51511721r_136881090
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- CCATCCTTTAATTTTAATAAAAGCTGAACTGTGTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACTTTTCTCAGTATTTCATTTCTATAGTCCAGTCTCTCTGCTATGTCTC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	5	r	136981090	137099448	15	99.3	Perfect prediction

Length: 625 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9UH77	100.0	Kelch-like prot...	Homo sapiens
Q5REP9	99.7	Kelch-like prot...	Pongo abelii
AAF20938	99.7	kelch-like prot...	Homo sapiens
XP_001112192	99.3	kelch-like 3 is...	Macaca mulatta
XP_001504377	98.3	similar to Kelc...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040923	7.5e-84	38.8	KIAA1490
AB051474	6.1e-80	37.2	KIAA1687
AB037799	4.6e-74	39.0	KIAA1378
D50922	1.7e-67	37.4	KIAA0132
AB018338	6.6e-67	39.1	KIAA0795

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR006651	478	491	PR00501	Kelch
	IPR006651	544	558	PR00501	Kelch
	IPR006651	607	619	PR00501	Kelch
HMMPfam	IPR013069	78	185	PF00651	BTB/POZ
	IPR011705	190	292	PF07707	BTB/Kelch-associated
	IPR006652	328	372	PF01344	Kelch repeat type 1
	IPR006652	374	419	PF01344	Kelch repeat type 1
	IPR006652	421	466	PF01344	Kelch repeat type 1
	IPR006652	468	515	PF01344	Kelch repeat type 1
	IPR006652	517	562	PF01344	Kelch repeat type 1
	IPR006652	564	609	PF01344	Kelch repeat type 1
HMMSmart	IPR000210	88	185	SM00225	BTB/POZ-like
	IPR006652	340	385	SM00612	Kelch repeat type 1
	IPR006652	386	432	SM00612	Kelch repeat type 1
	IPR006652	433	479	SM00612	Kelch repeat type 1
	IPR006652	480	528	SM00612	Kelch repeat type 1
	IPR006652	529	575	SM00612	Kelch repeat type 1
	IPR006652	576	623	SM00612	Kelch repeat type 1
ProfileScan	IPR000210	88	155	PS50097	BTB/POZ-like

Primer_f	CTGTGTTTCTACTGACCAAGC
Primer_r	ACTAGGGTGATTTGATGCTGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CTGTGTTTCTACTGACCAAGC
Primer_r	ACTAGGGTGATTTGATGCTGC
PCR product length	201 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles