KIAA1687

Product ID	ORK01177
Accession No	AB051474
Description	kelch-like family member 4, transcript variant 1
Clone name	fh26020
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5800 bp) Predicted protein sequence (728 aa)
HaloTag ORF Clone	FHC01177
Flexi ORF Clone	FXC01177
Source	Human fetal brain

Length: 5800 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	3515 bp
Genome contig ID	gi89161218f_86559425
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- AATTATAGTAATATTAATAAAAGTGTTAAAGCTTT
Flanking genome sequence (252283 - 252332)	----+--------+--------+--------+--------+----* TTCTCTCTTGACAATGCTTGCTTTTTAAGATTATGGCCTGCTACAGACTA

Length: 728 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9C0H6	100.0	Kelch-like prot...	Homo sapiens
BAG51715	99.9	unnamed protein...	Homo sapiens
AAK49442	100.0	kelch-like prot...	Homo sapiens
XP_001500754	91.4	kelch-like 4 (D...	Equus caballus
CAM45987	88.0	kelch-like 4 (D...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040923	4.4e-156	65.7	KIAA1490
AB032955	4.6e-69	37.3	KIAA1129
AB037799	1.4e-67	37.7	KIAA1378
D50922	2.2e-57	34.0	KIAA0132
AB037730	4.5e-45	29.8	KIAA1309

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR006651	485	498	PR00501	Kelch
	IPR006651	549	563	PR00501	Kelch
	IPR006651	564	576	PR00501	Kelch
HMMPfam	IPR013069	182	289	PF00651	BTB/POZ
	IPR011705	294	395	PF07707	BTB/Kelch-associated
	IPR006652	439	473	PF01344	Kelch repeat type 1
	IPR006652	475	520	PF01344	Kelch repeat type 1
	IPR006652	522	567	PF01344	Kelch repeat type 1
	IPR006652	569	614	PF01344	Kelch repeat type 1
	IPR006652	616	667	PF01344	Kelch repeat type 1
	IPR006652	669	714	PF01344	Kelch repeat type 1
HMMSmart	IPR000210	192	289	SM00225	BTB/POZ-like
	IPR006652	440	486	SM00612	Kelch repeat type 1
	IPR006652	487	533	SM00612	Kelch repeat type 1
	IPR006652	534	580	SM00612	Kelch repeat type 1
	IPR006652	581	627	SM00612	Kelch repeat type 1
	IPR006652	628	680	SM00612	Kelch repeat type 1
	IPR006652	681	727	SM00612	Kelch repeat type 1
ProfileScan	IPR000210	192	259	PS50097	BTB/POZ-like

Primer_f	GAATAGGCAAGGAGAACTGGG
Primer_r	TTTGTCCGAGGGCTTTGCATC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-