KIAA1378

Product ID	ORK00223
Accession No	AB037799
Description	kelch-like family member 8, transcript variant 2
Clone name	fj04831s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4345 bp) Predicted protein sequence (628 aa)
HaloTag ORF Clone	FHC00223
Flexi ORF Clone	FXC00223
Source	Human fetal brain
Rouge ID	mKIAA1378 by Kazusa Mouse cDNA Project
Note	We replaced fj04831, former representative clones for KIAA1378 with fj04831s1. (2002/5/10)

Length: 4345 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2457 bp
Genome contig ID	gi89161207r_88201520
PolyA signal sequence (None)	+--------+--------+----*----+---- ACTCCAGCGGTGAAACAAGAGTGAAACTCCATCTC
Flanking genome sequence (99718 - 99669)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAGATAAAAAAGCAGAATCAATATGTGCACAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	4	r	88301238	88335740	9	99.4	Perfect prediction

Length: 628 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9P2G9	100.0	Kelch-like prot...	Homo sapiens
XP_001157304	99.8	kelch-like 8 is...	Pan troglodytes
CAD98048	99.8	hypothetical pr...	Homo sapiens
BAG54740	99.8	unnamed protein...	Homo sapiens
AAH41384	99.8	Kelch-like 8 (D...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051474	1.5e-78	37.7	KIAA1687
AB032955	2.3e-74	39.0	KIAA1129
AB018338	2.4e-59	34.9	KIAA0795
D50922	2.8e-58	31.9	KIAA0132
AB037730	4.5e-38	27.1	KIAA1309

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR006651	373	386	PR00501	Kelch
	IPR006651	484	498	PR00501	Kelch
	IPR006651	546	558	PR00501	Kelch
HMMPfam	IPR013069	65	172	PF00651	BTB/POZ
	IPR011705	177	279	PF07707	BTB/Kelch-associated
	IPR006652	326	361	PF01344	Kelch repeat type 1
	IPR006652	363	408	PF01344	Kelch repeat type 1
	IPR006652	410	455	PF01344	Kelch repeat type 1
	IPR006652	457	502	PF01344	Kelch repeat type 1
	IPR006652	504	549	PF01344	Kelch repeat type 1
	IPR006652	551	596	PF01344	Kelch repeat type 1
HMMSmart	IPR000210	75	172	SM00225	BTB/POZ-like
	IPR006652	327	374	SM00612	Kelch repeat type 1
	IPR006652	375	421	SM00612	Kelch repeat type 1
	IPR006652	422	468	SM00612	Kelch repeat type 1
	IPR006652	469	515	SM00612	Kelch repeat type 1
	IPR006652	516	562	SM00612	Kelch repeat type 1
	IPR006652	563	609	SM00612	Kelch repeat type 1
ProfileScan	IPR000210	75	142	PS50097	BTB/POZ-like

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	84	KLISCHKLVLACVIPYFRAMFLS	106	PRIMARY	23
SOSUI2	2	144	NVQPLLYAACILQVELVARACCE	166	PRIMARY	23

Primer_f	GTTTGATCCAGTGCTGAATAG
Primer_r	GCCAGAACTCAAATCACATAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-