Order Kazusa clone(s) from : ![]() |
Product ID | ORK05758 |
---|---|
Accession No | AB037730 |
Description | kelch-like family member 13 |
Clone name | fh10381 |
Vector information | |
cDNA sequence | DNA sequence (5331 bp) Predicted protein sequence (639 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA1309
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1094 bp |
---|---|
Genome contig ID | gi89161218r_116815805 |
PolyA signal sequence (AATAAA,-19) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR013069 | 66 | 175 | PF00651 | BTB/POZ |
IPR011705 | 180 | 281 | PF07707 | BTB/Kelch-associated | |
IPR006652 | 313 | 360 | PF01344 | Kelch repeat type 1 | |
IPR006652 | 362 | 412 | PF01344 | Kelch repeat type 1 | |
IPR006652 | 414 | 459 | PF01344 | Kelch repeat type 1 | |
IPR006652 | 461 | 506 | PF01344 | Kelch repeat type 1 | |
IPR006652 | 508 | 558 | PF01344 | Kelch repeat type 1 | |
IPR006652 | 562 | 607 | PF01344 | Kelch repeat type 1 | |
HMMSmart | IPR000210 | 76 | 175 | SM00225 | BTB/POZ-like |
IPR006652 | 325 | 373 | SM00612 | Kelch repeat type 1 | |
IPR006652 | 374 | 425 | SM00612 | Kelch repeat type 1 | |
IPR006652 | 426 | 472 | SM00612 | Kelch repeat type 1 | |
IPR006652 | 473 | 519 | SM00612 | Kelch repeat type 1 | |
IPR006652 | 520 | 571 | SM00612 | Kelch repeat type 1 | |
IPR006652 | 572 | 620 | SM00612 | Kelch repeat type 1 | |
ProfileScan | IPR000210 | 76 | 145 | PS50097 | BTB/POZ-like |
![]() |
Primer_f | TGACTGTGTGGGTGCATTGAG |
---|---|
Primer_r | TAAGTAGAGGGTTCATGCTGC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TGACTGTGTGGGTGCATTGAG |
Primer_r | TAAGTAGAGGGTTCATGCTGC |
PCR product length | 104 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |