KIAA1384

Product ID	ORK00224
Accession No	AB037805
Description	kelch-like family member 14
Clone name	fj06146
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4261 bp) Predicted protein sequence (652 aa)
HaloTag ORF Clone	FHC00224
Flexi ORF Clone	FXC00224
Source	Human fetal brain
Rouge ID	mKIAA1384 by Kazusa Mouse cDNA Project

Length: 4261 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1986 bp
Genome contig ID	gi51511735r_28406632
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- GGGAAAACTTTAAATAAAAACTTTATGTACTAATT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* CAACTGTCTCTCATATCCTACTTACATATGTATAAATCTCTACATTAAAC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	18	r	28506632	28606972	9	100.0	Perfect prediction

Length: 652 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_855391	98.6	similar to Kelc...	Canis lupus fam...
Q9P2G3	100.0	Kelch-like prot...	Homo sapiens
XP_001100839	99.8	similar to kelc...	Macaca mulatta
EDK96966	98.9	mCG121003 [Mus ...	Mus musculus
EDL76108	98.9	similar to Kelc...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037730	6.7e-39	33.8	KIAA1309
AB037775	1.3e-38	33.4	KIAA1354
AB067487	4.9e-20	28.7	KIAA1900
AB032955	4.3e-16	26.7	KIAA1129
AB051464	5.1e-15	28.1	KIAA1677

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013069	47	205	PF00651	BTB/POZ
	IPR011705	210	303	PF07707	BTB/Kelch-associated
	IPR006652	335	383	PF01344	Kelch repeat type 1
	IPR006652	385	435	PF01344	Kelch repeat type 1
	IPR006652	437	482	PF01344	Kelch repeat type 1
	IPR006652	484	529	PF01344	Kelch repeat type 1
	IPR006652	531	580	PF01344	Kelch repeat type 1
	IPR006652	583	626	PF01344	Kelch repeat type 1
HMMSmart	IPR000210	57	205	SM00225	BTB/POZ-like
	IPR006652	347	396	SM00612	Kelch repeat type 1
	IPR006652	397	448	SM00612	Kelch repeat type 1
	IPR006652	449	495	SM00612	Kelch repeat type 1
	IPR006652	496	542	SM00612	Kelch repeat type 1
	IPR006652	543	594	SM00612	Kelch repeat type 1
	IPR006652	595	644	SM00612	Kelch repeat type 1
ProfileScan	IPR000210	57	175	PS50097	BTB/POZ-like

Primer_f	ATGTGCTGCTGCTCAACTTCG
Primer_r	TCGCATGAAATCCACTGACTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-