Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK05759 |
---|---|
Accession No | AB051464 |
Description | kelch-like family member 15 |
Clone name | fh18965 |
Vector information | |
cDNA sequence | DNA sequence (5765 bp) Predicted protein sequence (521 aa) |
Source | Human fetal brain |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 4197 bp |
---|---|
Genome contig ID | gi89161218r_23811762 |
PolyA signal sequence (AATAAA,-21) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR013069 | 2 | 45 | PF00651 | BTB/POZ |
IPR011705 | 50 | 154 | PF07707 | BTB/Kelch-associated | |
IPR006652 | 233 | 283 | PF01344 | Kelch repeat type 1 | |
IPR006652 | 285 | 330 | PF01344 | Kelch repeat type 1 | |
IPR006652 | 332 | 392 | PF01344 | Kelch repeat type 1 | |
IPR006652 | 394 | 446 | PF01344 | Kelch repeat type 1 | |
IPR006652 | 448 | 494 | PF01344 | Kelch repeat type 1 | |
HMMSmart | IPR006652 | 245 | 296 | SM00612 | Kelch repeat type 1 |
IPR006652 | 297 | 343 | SM00612 | Kelch repeat type 1 | |
IPR006652 | 344 | 405 | SM00612 | Kelch repeat type 1 | |
IPR006652 | 406 | 459 | SM00612 | Kelch repeat type 1 | |
IPR006652 | 460 | 509 | SM00612 | Kelch repeat type 1 |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 25 | AMYVQLIEVVKFCCSFLLAKICL | 47 | PRIMARY | 23 |
---|
RT-PCR-ELISA |
Primer_f | TCTGTGTCCTCATTACTCTGC |
---|---|
Primer_r | CCTTTACTATGACTCGAGCAG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | CCR |
---|---|
Primer_f | TCTGTGTCCTCATTACTCTGC |
Primer_r | CCTTTACTATGACTCGAGCAG |
PCR product length | 137 bp |
PCR conditions | 95 °C15 sec62 °C60 sec30 cycles |