KIAA1490

Product ID	ORK00850
Accession No	AB040923
Description	kelch-like family member 1, transcript variant 1
Clone name	fj08103
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4115 bp) Predicted protein sequence (749 aa)
HaloTag ORF Clone	FHC00850
Flexi ORF Clone	FXC00850
Source	Human fetal brain
Rouge ID	mKIAA1490 by Kazusa Mouse cDNA Project

Length: 4115 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1108 bp
Genome contig ID	gi51511729r_69072727
PolyA signal sequence (AATAAA,-26)	+--------+--------+----*----+---- ATTACAATTAATAAATGATCAAAAAATTTGCATTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATCAGTGTATTTTTAATAAATTTTAAATCGAATGTAAGGATAAAGTCAAC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	13	r	69172727	69580592	11	99.7	Perfect prediction

Length: 749 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9NR64	100.0	Kelch-like prot...	Homo sapiens
AAH22460	99.9	Kelch-like 1 (D...	Homo sapiens
XP_509677	98.9	kelch-like 1 pr...	Pan troglodytes
XP_001494749	97.3	similar to Kelc...	Equus caballus
XP_871735	96.3	similar to Kelc...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051474	5.8e-127	65.9	KIAA1687
AB032955	1.2e-58	38.8	KIAA1129
D50922	4.6e-48	34.6	KIAA0132
AB037730	1.6e-35	29.9	KIAA1309
AB037775	4.3e-35	29.5	KIAA1354

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013069	203	310	PF00651	BTB/POZ
	IPR011705	315	416	PF07707	BTB/Kelch-associated
	IPR006652	460	494	PF01344	Kelch repeat type 1
	IPR006652	496	541	PF01344	Kelch repeat type 1
	IPR006652	543	588	PF01344	Kelch repeat type 1
	IPR006652	590	635	PF01344	Kelch repeat type 1
	IPR006652	637	688	PF01344	Kelch repeat type 1
	IPR006652	690	735	PF01344	Kelch repeat type 1
HMMSmart	IPR000210	213	310	SM00225	BTB/POZ-like
	IPR006652	461	507	SM00612	Kelch repeat type 1
	IPR006652	508	554	SM00612	Kelch repeat type 1
	IPR006652	555	601	SM00612	Kelch repeat type 1
	IPR006652	602	648	SM00612	Kelch repeat type 1
	IPR006652	649	701	SM00612	Kelch repeat type 1
	IPR006652	702	748	SM00612	Kelch repeat type 1
ProfileScan	IPR000210	213	280	PS50097	BTB/POZ-like

Primer_f	TTCTGCCTCATTTTCCTAAGC
Primer_r	GTGTTTGCCAGTTTCAGATTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-