KIAA0469

Product ID	ORK05763
Accession No	AB007938
Description	kelch-like family member 21
Clone name	hg01666
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6450 bp) Predicted protein sequence (559 aa)
Source	Human adult brain
Rouge ID	mKIAA0469 by Kazusa Mouse cDNA Project

Length: 6450 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	Warning

Integrity of 3' end

Length of 3'UTR	4646 bp
Genome contig ID	gi89161185r_6473366
PolyA signal sequence (AATAAA,-26)	+--------+--------+----*----+---- ACTTTTTGCAATAAAAGTATTTCCTATCCATTTGG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGTCATTGCCTTTGTCCTCCTGCTACTGTCTTCTGGGACTCTTGGGCTGA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	r	6573366	6585648	3	99.2	Perfect prediction

Length: 559 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
CAI16082	0	99.8	kelch-like 21 (...	Homo sapiens
Q9UJP4	2.9e-214	99.8	Kelch-like prot...	Homo sapiens
BAG52104	1.1e-213	99.6	unnamed protein...	Homo sapiens
XP_001094118	1.1e-213	99.4	similar to kelc...	Macaca mulatta
XP_546754	4.5e-212	98.4	similar to kelc...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB032955	6e-39	30.6	KIAA1129
AB051474	6.1e-37	30.4	KIAA1687
AB040923	2.6e-35	28.8	KIAA1490
AB067508	9.7e-33	34.8	KIAA1921
AB037799	3.6e-30	27.1	KIAA1378

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013069	45	153	PF00651	BTB/POZ
	IPR011705	158	259	PF07707	BTB/Kelch-associated
	IPR006652	295	341	PF01344	Kelch repeat type 1
	IPR006652	344	389	PF01344	Kelch repeat type 1
	IPR006652	391	429	PF01344	Kelch repeat type 1
	IPR006652	431	475	PF01344	Kelch repeat type 1
	IPR006652	502	519	PF01344	Kelch repeat type 1
HMMSmart	IPR000210	55	153	SM00225	BTB/POZ-like
	IPR006652	307	354	SM00612	Kelch repeat type 1
	IPR006652	356	402	SM00612	Kelch repeat type 1
	IPR006652	403	442	SM00612	Kelch repeat type 1
ProfileScan	IPR000210	55	123	PS50097	BTB/POZ-like

Primer_f
Primer_r
PCR conditions	°C sec °C sec cycles

Panel name	GeneBridge 4
Primer_f	CTCTGGGGTGAACTGGATGTG
Primer_r	ATAGATGTTGGGATGCCTGGG
PCR product length	202 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles