KIAA1769

Product ID	ORK01636
Accession No	AB051556
Description	helicase with zinc finger 2, transcriptional coactivator, transcript variant 2
Clone name	af00171
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (7484 bp) Predicted protein sequence (2114 aa)
HaloTag ORF Clone	FHC01636
Flexi ORF Clone	FXC01636
Source	Human brain (amygdala)
Rouge ID	mKIAA1769 by Kazusa Mouse cDNA Project
Note	We replaced pj00758, former representative clones for KIAA1769 with af00171. (2001/5/29)

Length: 7484 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1137 bp
Genome contig ID	gi51511747r_61559908
PolyA signal sequence (None)	+--------+--------+----*----+---- CTTTGAATTATGTGATTAGATATTAATTTAATGAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAACCACTCTGAAAGCTCTTCTCACTTCTGGGTGTTTGAGGTCTGGCTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	20	r	61659908	61669551	14	99.2	Perfect prediction

Length: 2114 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAM74197	100.0	peroxisomal pro...	Homo sapiens
EAW75255	99.9	peroxisomal pro...	Homo sapiens
CAI95749	99.8	peroxisomal pro...	Homo sapiens
Q9BYK8	99.4	Peroxisomal pro...	Homo sapiens
NP_001032412	99.3	PPAR-alpha inte...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D29677	8.7e-36	41.0	KIAA0054
AB075835	6.1e-18	24.6	KIAA1955
AB023225	4.8e-12	24.0	KIAA1008
AB046851	1.9e-09	26.0	KIAA1631
D42046	2.7e-05	27.2	KIAA0083

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001900	799	1158	PF00773	Ribonuclease II and R
ScanRegExp	IPR001900	1125	1149	PS01175	Ribonuclease II and R

Primer_f	AATGAGCGGCTGCAAAACCTG
Primer_r	GTCTTCAGCTTGCTCTTGTAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	CCR
Primer_f	AATGAGCGGCTGCAAAACCTG
Primer_r	GTCTTCAGCTTGCTCTTGTAG
PCR product length	146(250) bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles