Gene/Protein Characteristic Table for KIAA1907
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK05802
Accession No AB067494
Description laminin, alpha 5
Clone name ah00504
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (5213 bp)
Predicted protein sequence (1737 aa)
Source Human brain (amygdala)
Features of the cloned cDNA sequence
Description

Length: 5213 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning Warning
Integrity of 3' end
Length of 3'UTR 0 bp
Genome contig ID gi51511747r_60232531
PolyA signal sequence
(None)		 
+----*----+----*----+----*----+----
ACTTCGCCGAGGGCTGTGTCCTGCGAGGCGGCCGC
Flanking genome sequence
(99743 - 99694)		 
----+----*----+----*----+----*----+----*----+----*
ACCCAGTGCCTCTGCAAACCTGGTTATGCAGGTGCCTCCTGCGAGCGGTG

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 20 r 60332274 60360790 41 99.9 Perfect prediction
Features of the protein sequence
Description

Length: 1737 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
AAM12527 0 99.8 laminin alpha5 ...
 Homo sapiens
CAC22310 0 99.8 laminin, alpha ...
 Homo sapiens
NP_005551 0 99.8 laminin alpha 5...
 Homo sapiens
EAW75374 0 99.7 laminin, alpha ...
 Homo sapiens
O15230 0 99.7 Laminin subunit...
 Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB011539 2.1e-19 32.2 KIAA0815
AB058676 8.1e-18 29.6 KIAA1780
D63483 5.5e-15 31.9 KIAA0149
AB058760 4.7e-13 30.0 KIAA1857
AB011542 4.9e-11 33.9 KIAA0818
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR000034 1413 1587 PD003031 Laminin B
FPrintScan IPR002049 492 510 PR00011 EGF-like
IPR002049 593 611 PR00011 EGF-like
IPR002049 1346 1364 PR00011 EGF-like
HMMPfam IPR008211 13 101 PF00055 Laminin
IPR002049 103 159 PF00053 EGF-like
IPR002049 162 229 PF00053 EGF-like
IPR002049 232 274 PF00053 EGF-like
IPR002049 297 341 PF00053 EGF-like
IPR002049 344 387 PF00053 EGF-like
IPR002049 390 432 PF00053 EGF-like
IPR002049 435 477 PF00053 EGF-like
IPR002049 480 528 PF00053 EGF-like
IPR002049 547 576 PF00053 EGF-like
IPR002049 579 629 PF00053 EGF-like
IPR002049 632 664 PF00053 EGF-like
IPR002049 1241 1289 PF00053 EGF-like
IPR002049 1331 1377 PF00053 EGF-like
IPR002049 1380 1428 PF00053 EGF-like
IPR000034 1496 1632 PF00052 Laminin B
IPR002049 1634 1664 PF00053 EGF-like
IPR002049 1667 1713 PF00053 EGF-like
HMMSmart IPR008211 1 101 SM00136 Laminin
IPR002049 103 159 SM00180 EGF-like
IPR006210 158 209 SM00181 EGF
IPR002049 162 229 SM00180 EGF-like
IPR006210 228 262 SM00181 EGF
IPR002049 232 274 SM00180 EGF-like
IPR002049 297 341 SM00180 EGF-like
IPR006210 308 342 SM00181 EGF
IPR006210 343 388 SM00181 EGF
IPR002049 344 387 SM00180 EGF-like
IPR002049 390 432 SM00180 EGF-like
IPR006210 391 433 SM00181 EGF
IPR002049 435 477 SM00180 EGF-like
IPR006210 436 478 SM00181 EGF
IPR002049 480 523 SM00180 EGF-like
IPR006210 481 524 SM00181 EGF
IPR002049 527 576 SM00180 EGF-like
IPR006210 527 580 SM00181 EGF
IPR002049 579 629 SM00180 EGF-like
IPR002049 632 676 SM00180 EGF-like
IPR002049 1241 1284 SM00180 EGF-like
IPR002049 1287 1328 SM00180 EGF-like
IPR006210 1330 1378 SM00181 EGF
IPR002049 1331 1377 SM00180 EGF-like
IPR002049 1380 1428 SM00180 EGF-like
IPR000034 1491 1621 SM00281 Laminin B
IPR006210 1666 1714 SM00181 EGF
IPR002049 1667 1713 SM00180 EGF-like
ProfileScan IPR008211 1 102 PS51117 Laminin
IPR002049 103 161 PS50027 EGF-like
IPR002049 162 231 PS50027 EGF-like
IPR002049 232 276 PS50027 EGF-like
IPR002049 297 343 PS50027 EGF-like
IPR002049 344 394 PS50027 EGF-like
IPR002049 396 434 PS50027 EGF-like
IPR002049 435 479 PS50027 EGF-like
IPR002049 480 530 PS50027 EGF-like
IPR002049 535 578 PS50027 EGF-like
IPR002049 579 631 PS50027 EGF-like
IPR002049 632 677 PS50027 EGF-like
IPR002049 1241 1286 PS50027 EGF-like
IPR002049 1287 1330 PS50027 EGF-like
IPR002049 1331 1379 PS50027 EGF-like
IPR002049 1380 1430 PS50027 EGF-like
IPR000034 1451 1633 PS51115 Laminin B
IPR001368 1647 1695 PS50050 TNFR/CD27/30/40/95 cysteine-rich region
IPR002049 1667 1715 PS50027 EGF-like
ScanRegExp IPR013032 125 136 PS00022 EGF-like region
IPR002049 125 159 PS01248 EGF-like
IPR002049 196 232 PS01248 EGF-like
IPR013032 250 261 PS00022 EGF-like region
IPR002049 250 274 PS01248 EGF-like
IPR013032 318 329 PS00022 EGF-like region
IPR002049 318 346 PS01248 EGF-like
IPR013032 363 374 PS00022 EGF-like region
IPR013032 363 377 PS01186 EGF-like region
IPR002049 363 392 PS01248 EGF-like
IPR013032 408 419 PS00022 EGF-like region
IPR002049 408 437 PS01248 EGF-like
IPR013032 453 464 PS00022 EGF-like region
IPR013032 453 467 PS01186 EGF-like region
IPR002049 453 482 PS01248 EGF-like
IPR013032 499 510 PS00022 EGF-like region
IPR002049 499 528 PS01248 EGF-like
IPR013032 547 558 PS00022 EGF-like region
IPR002049 547 581 PS01248 EGF-like
IPR013032 600 611 PS00022 EGF-like region
IPR002049 600 634 PS01248 EGF-like
IPR013032 651 662 PS00022 EGF-like region
IPR013032 1260 1271 PS00022 EGF-like region
IPR002049 1260 1294 PS01248 EGF-like
IPR013032 1353 1364 PS00022 EGF-like region
IPR002049 1353 1382 PS01248 EGF-like
IPR013032 1399 1410 PS00022 EGF-like region
IPR002049 1399 1433 PS01248 EGF-like
IPR013032 1634 1645 PS00022 EGF-like region
IPR002049 1634 1669 PS01248 EGF-like
IPR002049 1683 1718 PS01248 EGF-like
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f GCTACTGTAAGGAGAACGTGC
Primer_r CTCCATATCCACGAACTCCTG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 20
Experimental conditions
Panel name genbank
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp