KIAA1975

Product ID	ORK05737
Accession No	AB075855
Description	ankyrin repeat and GTPase domain Arf GTPase activating protein 11
Clone name	aj01061
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4559 bp) Predicted protein sequence (597 aa)
Source	Human brain (amygdala)

Length: 4559 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	Warning

Integrity of 3' end

Length of 3'UTR	298 bp
Genome contig ID	gi89161187f_88642143
PolyA signal sequence (AATATA,-21)	+--------+--------+----*----+---- ATAAGATGTGTGAAAATATATTTGAAAAAAAGTTC
Flanking genome sequence (117799 - 117848)	----+--------+--------+--------+--------+----* ATAAATATGCATTGATTTTTGTACATATGGCACCTCTTTTTCATTTTTAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	10	f	88742143	88759940	7	99.5	Perfect prediction

Length: 597 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW80309	1.8e-190	100.0	hCG1994053, iso...	Homo sapiens
XP_001082744	2.2e-172	82.2	similar to cent...	Macaca mulatta
NP_055729	3.4e-172	82.4	centaurin, gamm...	Homo sapiens
EAW71079	4e-172	82.2	centaurin, gamm...	Homo sapiens
AAL04172	9.7e-172	82.0	centaurin gamma...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB029022	8.8e-128	82.0	KIAA1099
D79989	2.5e-52	48.5	KIAA0167
AB051503	5.4e-16	41.0	KIAA1716
AB033075	8.4e-16	31.4	KIAA1249
D26069	7.3e-15	31.6	KIAA0041

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001164	387	406	PR00405	Arf GTPase activating protein
	IPR001164	406	423	PR00405	Arf GTPase activating protein
	IPR001164	427	448	PR00405	Arf GTPase activating protein
	IPR002110	535	547	PR01415	Ankyrin
	IPR002110	580	592	PR01415	Ankyrin
HMMPfam	IPR001849	169	354	PF00169	Pleckstrin-like
	IPR001164	375	495	PF01412	Arf GTPase activating protein
	IPR002110	534	566	PF00023	Ankyrin
	IPR002110	567	592	PF00023	Ankyrin
HMMSmart	IPR001849	169	356	SM00233	Pleckstrin-like
	IPR001164	375	495	SM00105	Arf GTPase activating protein
	IPR002110	534	563	SM00248	Ankyrin
	IPR002110	567	596	SM00248	Ankyrin
ProfileScan	IPR001849	168	354	PS50003	Pleckstrin-like
	IPR001164	375	495	PS50115	Arf GTPase activating protein
	IPR002110	502	591	PS50297	Ankyrin
	IPR002110	534	566	PS50088	Ankyrin

Primer_f	GCAGAGCCATCCCCATTAAAC
Primer_r	TTCCTGGGACTTTGATGGTAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-