|
Order Kazusa clone(s) from : |
| Product ID | ORK05015 |
|---|---|
| Accession No | AK000004 |
| Clone name | as00004 |
| Vector information | |
| cDNA sequence | DNA sequence (4670 bp) Predicted protein sequence (698 aa) |
| Source | Human spleen |
Length: 4670 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | No warning | Warning |
Length: 698 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against other entries from Kazusa human cDNA project
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)
Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| HMMPfam | IPR000219 | 225 | 404 | PF00621 | DH domain |
| IPR001849 | 435 | 533 | PF00169 | Pleckstrin-like | |
| IPR000306 | 591 | 651 | PF01363 | Zn-finger | |
| HMMSmart | IPR000219 | 225 | 404 | SM00325 | DH domain |
| IPR001849 | 435 | 535 | SM00233 | Pleckstrin-like | |
| IPR000306 | 588 | 653 | SM00064 | Zn-finger | |
| ProfileScan | IPR000219 | 221 | 405 | PS50010 | DH domain |
| IPR001849 | 434 | 533 | PS50003 | Pleckstrin-like | |
| IPR000306 | 596 | 652 | PS50178 | Zn-finger |
RT-PCR-ELISA
|
Experimental conditions| Primer_f | GCAAACCCCATCTGATACCAC |
|---|---|
| Primer_r | ACACAAAGACACAGGTTAGGG |
| PCR conditions | 95 °C 30 sec 55 °C 30 sec 72 °C 60 sec 30 cycles![]() |