Gene/Protein Characteristic Table for FLJ00004
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK05015
Accession No AK000004
Clone name as00004
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4670 bp)
Predicted protein sequence (698 aa)
Source Human spleen
Features of the cloned cDNA sequence
Description

Length: 4670 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning Warning
Features of the protein sequence
Description

Length: 698 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAA92229 0 100.0 FLJ00004 protei...
Homo sapiens
AAP20645 0 99.7 FGD3 [Homo sapi...
Homo sapiens
AAH32429 7.1e-214 96.3 FGD3 protein [H...
Homo sapiens
Q5JSP0 8e-214 96.2 FYVE, RhoGEF an...
Homo sapiens
BAF85365 1.5e-213 96.0 unnamed protein...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against other entries from Kazusa human cDNA project (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB037783 3.8e-19 29.0 KIAA1362
AK131078 4.6e-13 25.6 FLJ00274
AB018336 3.3e-12 27.1 KIAA0793
AB037836 4.2e-09 25.8 KIAA1415
AB002335 6.4e-09 23.6 KIAA0337
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000219 225 404 PF00621 DH domain
IPR001849 435 533 PF00169 Pleckstrin-like
IPR000306 591 651 PF01363 Zn-finger
HMMSmart IPR000219 225 404 SM00325 DH domain
IPR001849 435 535 SM00233 Pleckstrin-like
IPR000306 588 653 SM00064 Zn-finger
ProfileScan IPR000219 221 405 PS50010 DH domain
IPR001849 434 533 PS50003 Pleckstrin-like
IPR000306 596 652 PS50178 Zn-finger
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f GCAAACCCCATCTGATACCAC
Primer_r ACACAAAGACACAGGTTAGGG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the NEDO Protein Database homepage
Send a message to office AT kazusa.or.jp