Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK05015 |
---|---|
Accession No | AK000004 |
Clone name | as00004 |
Vector information | |
cDNA sequence | DNA sequence (4670 bp) Predicted protein sequence (698 aa) |
Source | Human spleen |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | Warning |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against other entries from Kazusa human cDNA project (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000219 | 225 | 404 | PF00621 | DH domain |
IPR001849 | 435 | 533 | PF00169 | Pleckstrin-like | |
IPR000306 | 591 | 651 | PF01363 | Zn-finger | |
HMMSmart | IPR000219 | 225 | 404 | SM00325 | DH domain |
IPR001849 | 435 | 535 | SM00233 | Pleckstrin-like | |
IPR000306 | 588 | 653 | SM00064 | Zn-finger | |
ProfileScan | IPR000219 | 221 | 405 | PS50010 | DH domain |
IPR001849 | 434 | 533 | PS50003 | Pleckstrin-like | |
IPR000306 | 596 | 652 | PS50178 | Zn-finger |
RT-PCR-ELISA |
Primer_f | GCAAACCCCATCTGATACCAC |
---|---|
Primer_r | ACACAAAGACACAGGTTAGGG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |