Gene/Protein Characteristic Table for FLJ00047
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK05046
Accession No AK024455
Clone name as00047
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4255 bp)
Predicted protein sequence (81 aa)
Source Human spleen
Features of the cloned cDNA sequence
Description

Length: 4255 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Features of the protein sequence
Description

Length: 81 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAB15745 2e-33 100.0 FLJ00047 protei...
Homo sapiens
EAX03104 3e-09 55.7 hCG1820927, iso...
Homo sapiens
BAA91205 2.6e-08 57.1 unnamed protein...
Homo sapiens
EAW57950 3.2e-08 57.1 hypothetical pr...
Homo sapiens
EAW74477 9.4e-08 60.0 hCG2040729 [Hom...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against other entries from Kazusa human cDNA project (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB007969 2.2e-06 41.0 KIAA0500
AB002362 0.00016 57.6 KIAA0364
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
ProfileScan NULL 22 44 PS50314 NULL

Prediction of transmembrane (TM) segments
Method No. N terminal transmembrane region C terminal type length
SOSUI2 1 24 FFSFFFFGLFFFFLFVCLFCFLR 46 PRIMARY 23
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f TGCAGCTGATGAGGGAAGAAC
Primer_r CAGCCTTTTCTTAATGGTCAC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the NEDO Protein Database homepage
Send a message to office AT kazusa.or.jp