KIAA1127

Product ID	ORK06219
Accession No	AB032953
Description	teneurin transmembrane protein 2
Clone name	bf00005
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector(Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGC TGAAGCTTTC ACAAGTTTGT ACAAAAAAGC AGGCTCTTC-5' end of cDNA, GAGCTCTCAC CACTTTGTAC AAGAAAGCTG GGCGGCCGCT TTTTTTTTTT TTTTTTT-3' end of cDNA).
cDNA sequence	DNA sequence (7781 bp) Predicted protein sequence (2144 aa)
Source	Human adult brain
Rouge ID	mKIAA1127 by Kazusa Mouse cDNA Project
Note	We replaced hg02791, former representative clones for KIAA1127 with bf00005. (2002/12/27)

Length: 7781 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1346 bp
Genome contig ID	gi51511721f_167377952
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- TTTATACATAAATAAAGTCTCTAAAACTCCTGTGG
Flanking genome sequence (245789 - 245838)	----+--------+--------+--------+--------+----* ACACTGGTCTTGTGTGGAAATGATTTGAGATGAGAAAAAGGCAAGCGTTA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	5	f	167477952	167623739	20	99.5	Perfect prediction

Length: 2144 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9NT68	100.0	Teneurin-2; Sho...	Homo sapiens
EAW61511	100.0	hCG38403, isofo...	Homo sapiens
EAW61512	100.0	hCG38403, isofo...	Homo sapiens
XP_001090928	99.6	similar to odd ...	Macaca mulatta
XP_001090700	99.6	similar to odd ...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040888	0	70.8	KIAA1455
AB037723	0	66.5	KIAA1302
D63483	1e-17	32.0	KIAA0149
AB011541	2.5e-10	46.6	KIAA0817
AB011539	3.1e-09	30.5	KIAA0815

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013111	10	37	PF07974	EGF
	IPR013111	42	69	PF07974	EGF
	IPR013111	76	104	PF07974	EGF
	IPR013111	109	135	PF07974	EGF
	IPR006209	140	166	PF00008	EGF-like
	IPR006209	180	210	PF00008	EGF-like
	IPR001258	607	633	PF01436	NHL repeat
	IPR001258	652	683	PF01436	NHL repeat
	IPR001258	725	750	PF01436	NHL repeat
	IPR001258	784	819	PF01436	NHL repeat
	IPR001258	844	871	PF01436	NHL repeat
	IPR001258	913	940	PF01436	NHL repeat
	IPR006530	1052	1090	PF05593	YD repeat
	IPR006530	1370	1406	PF05593	YD repeat
	IPR006530	1575	1611	PF05593	YD repeat
	IPR006530	1650	1688	PF05593	YD repeat
HMMSmart	IPR006210	2	38	SM00181	EGF
	IPR001881	39	70	SM00179	EGF-like calcium-binding
	IPR006210	41	70	SM00181	EGF
	IPR006210	75	105	SM00181	EGF
	IPR006210	108	136	SM00181	EGF
	IPR006210	139	167	SM00181	EGF
	IPR001881	176	211	SM00179	EGF-like calcium-binding
	IPR006210	179	211	SM00181	EGF
HMMTigr	IPR006530	989	1030	TIGR01643	YD repeat
	IPR006530	1053	1094	TIGR01643	YD repeat
	IPR006530	1265	1305	TIGR01643	YD repeat
	IPR006530	1549	1595	TIGR01643	YD repeat
	IPR006530	1650	1692	TIGR01643	YD repeat
ProfileScan	IPR000742	6	38	PS50026	EGF-like
	IPR000742	72	105	PS50026	EGF-like
	IPR000742	136	167	PS50026	EGF-like
	IPR000742	176	211	PS50026	EGF-like
ScanRegExp	IPR013032	26	37	PS00022	EGF-like region
	IPR013032	26	37	PS01186	EGF-like region
	IPR013032	58	69	PS00022	EGF-like region
	IPR013032	58	69	PS01186	EGF-like region
	IPR013032	93	104	PS00022	EGF-like region
	IPR013032	124	135	PS00022	EGF-like region
	IPR013032	124	135	PS01186	EGF-like region
	IPR013032	155	166	PS00022	EGF-like region
	IPR013032	155	166	PS01186	EGF-like region
	IPR013032	199	210	PS00022	EGF-like region
	IPR013032	199	210	PS01186	EGF-like region

Primer_f	CGACTTTGGGGGTGATTTGTG
Primer_r	TGGGACCTGAGAGTTAAGTGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CTGTTTAGATTCCGTAGTTCG
Primer_r	CCTTTCGGCTCATGTATGTAC
PCR product length	112 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles