KIAA1297

Product ID	ORK06960
Accession No	AB037718
Description	SPEG complex locus
Clone name	fg03883
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6726 bp) Predicted protein sequence (2242 aa)
Source	Human fetal brain
Rouge ID	mKIAA1297 by Kazusa Mouse cDNA Project

Length: 6726 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	0 bp
Genome contig ID	gi89161199f_219940202
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- CTGTCTGCCACAAGGAAATAAAAATGGCAAGCAGC
Flanking genome sequence (126394 - 126443)	----+--------+--------+--------+--------+----* ATAACCTGTGTGTCTATTGGGAGGGATGGCTGGAGGGGAAGATGGCTGGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	f	220040202	220066594	32	99.5	Perfect prediction

Length: 2242 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAT80901	100.0	striated muscle...	Homo sapiens
EAW70752	99.6	hCG1811882, iso...	Homo sapiens
Q15772	99.7	Striated muscle...	Homo sapiens
EAW70753	99.9	hCG1811882, iso...	Homo sapiens
ACH95326	92.9	SPEG complex lo...	Otolemur garnettii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB046859	4.1e-09	28.5	KIAA1639
AB023185	1e-05	31.4	KIAA0968
AB051552	0.00032	24.6	KIAA1765
AB018265	0.00047	24.8	KIAA0722
AB002367	0.00059	30.4	KIAA0369

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	620	873	PD000001	Protein kinase
BlastProDom	IPR000719	2036	2231	PD000001	Protein kinase
HMMPfam	IPR013151	1	62	PF00047	Immunoglobulin
	IPR013098	83	172	PF07679	Immunoglobulin I-set
	IPR013098	207	296	PF07679	Immunoglobulin I-set
	IPR003961	301	390	PF00041	Fibronectin
	IPR013098	409	500	PF07679	Immunoglobulin I-set
	IPR013098	504	593	PF07679	Immunoglobulin I-set
	IPR000719	620	873	PF00069	Protein kinase
	IPR013098	1603	1693	PF07679	Immunoglobulin I-set
	IPR003961	1697	1779	PF00041	Fibronectin
	IPR000719	1985	2235	PF00069	Protein kinase
HMMSmart	IPR003598	1	67	SM00408	Immunoglobulin subtype 2
	IPR003599	1	78	SM00409	Immunoglobulin subtype
	IPR003599	89	173	SM00409	Immunoglobulin subtype
	IPR003598	95	162	SM00408	Immunoglobulin subtype 2
	IPR003599	213	297	SM00409	Immunoglobulin subtype
	IPR003598	219	286	SM00408	Immunoglobulin subtype 2
	IPR003961	301	387	SM00060	Fibronectin
	IPR003599	415	501	SM00409	Immunoglobulin subtype
	IPR003598	421	490	SM00408	Immunoglobulin subtype 2
	IPR003599	510	594	SM00409	Immunoglobulin subtype
	IPR003598	516	583	SM00408	Immunoglobulin subtype 2
	IPR002290	620	873	SM00220	Serine/threonine protein kinase
	IPR003599	1609	1694	SM00409	Immunoglobulin subtype
	IPR003598	1615	1683	SM00408	Immunoglobulin subtype 2
	IPR003961	1697	1776	SM00060	Fibronectin
	IPR001245	1985	2237	SM00219	Tyrosine protein kinase
	IPR002290	1985	2237	SM00220	Serine/threonine protein kinase
ProfileScan	IPR007110	1	76	PS50835	Immunoglobulin-like
	IPR007110	83	171	PS50835	Immunoglobulin-like
	IPR007110	207	297	PS50835	Immunoglobulin-like
	IPR003961	301	396	PS50853	Fibronectin
	IPR007110	504	592	PS50835	Immunoglobulin-like
	IPR000719	620	873	PS50011	Protein kinase
	IPR007110	1602	1692	PS50835	Immunoglobulin-like
	IPR003961	1693	1788	PS50853	Fibronectin
	IPR000719	1985	2237	PS50011	Protein kinase
ScanRegExp	IPR000719	626	649	PS00107	Protein kinase
	IPR008271	734	746	PS00108	Serine/threonine protein kinase
	IPR008271	2100	2112	PS00108	Serine/threonine protein kinase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	797	TDIWPVGVVAFLCLTGISPFVGE	819	PRIMARY	23

Primer_f	CAGTGACAGGTTCCGGTATTC
Primer_r	TTGTCTGGCTTGATGTCTAGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GGCATCCCCGACTGTTACTAC
Primer_r	TGAGTACCCCTGACAAAGACC
PCR product length	137 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles