Order Kazusa clone(s) from : ![]() |
Product ID | ORK01622 |
---|---|
Accession No | AB028950 |
Description | talin 1 |
Clone name | fh00156s1 |
Vector information | |
cDNA sequence | DNA sequence (8405 bp) Predicted protein sequence (2550 aa) |
HaloTag ORF Clone |
FHC01622
![]() |
Flexi ORF Clone | FXC01622 |
Source | Human fetal brain |
Rouge ID |
mKIAA1027
by Kazusa Mouse cDNA Project
|
Note | We replaced fh00156, former representative clones for KIAA1027 with fh00156s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 450 bp |
---|---|
Genome contig ID | gi89161216r_35587338 |
PolyA signal sequence (AATAAA,-19) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 9 | r | 35687338 | 35722367 | 57 | 99.9 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR002558 | 700 | 771 | PD011820 | I/LWEQ |
IPR002558 | 1430 | 1628 | PD011820 | I/LWEQ | |
IPR002558 | 2305 | 2539 | PD011820 | I/LWEQ | |
HMMPfam | IPR000299 | 130 | 322 | PF00373 | Band 4.1 |
IPR015224 | 500 | 661 | PF09141 | Talin | |
IPR015009 | 1243 | 1352 | PF08913 | Vinculin Binding Site | |
IPR015009 | 1858 | 1982 | PF08913 | Vinculin Binding Site | |
IPR002558 | 2350 | 2542 | PF01608 | I/LWEQ | |
HMMSmart | IPR000299 | 91 | 322 | SM00295 | Band 4.1 |
IPR002558 | 2345 | 2542 | SM00307 | I/LWEQ | |
ProfileScan | IPR000299 | 95 | 412 | PS50057 | Band 4.1 |
IPR002558 | 2302 | 2542 | PS50945 | I/LWEQ | |
ScanRegExp | IPR000299 | 182 | 210 | PS00660 | Band 4.1 |
IPR000299 | 292 | 321 | PS00661 | Band 4.1 |
![]() |
Primer_f | TGAAAGAGAAGATGGTTGGCG |
---|---|
Primer_r | AAACTTGTACTGCTGCTGCCG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TGAAAGAGAAGATGGTTGGCG |
Primer_r | AAACTTGTACTGCTGCTGCCG |
PCR product length | 128 (0.3k) bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |