KIAA1027

Product ID	ORK01622
Accession No	AB028950
Description	talin 1
Clone name	fh00156s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (8405 bp) Predicted protein sequence (2550 aa)
HaloTag ORF Clone	FHC01622
Flexi ORF Clone	FXC01622
Source	Human fetal brain
Rouge ID	mKIAA1027 by Kazusa Mouse cDNA Project
Note	We replaced fh00156, former representative clones for KIAA1027 with fh00156s1. (2002/5/10)

Length: 8405 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	450 bp
Genome contig ID	gi89161216r_35587338
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- AAACAGGTCATGCTCCAATAAAAATGATTCTACCT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACAACCTCTGCCTGGCTTCAAGGGAGATACAAGTTTTCTCCCAGGGCAGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	9	r	35687338	35722367	57	99.9	Perfect prediction

Length: 2550 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9Y490	100.0	Talin-1.	Homo sapiens
AAH42923	100.0	Talin 1 [Homo s...	Homo sapiens
AAF27330	100.0	talin [Homo sap...	Homo sapiens
EAW58353	99.9	talin 1, isofor...	Homo sapiens
AAF23322	99.8	talin [Homo sap...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002318	0	74.3	KIAA0320
AB014555	4.3e-12	22.6	KIAA0655
AB002336	0.0003	20.7	KIAA0338

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR002558	700	771	PD011820	I/LWEQ
	IPR002558	1430	1628	PD011820	I/LWEQ
	IPR002558	2305	2539	PD011820	I/LWEQ
HMMPfam	IPR000299	130	322	PF00373	Band 4.1
	IPR015224	500	661	PF09141	Talin
	IPR015009	1243	1352	PF08913	Vinculin Binding Site
	IPR015009	1858	1982	PF08913	Vinculin Binding Site
	IPR002558	2350	2542	PF01608	I/LWEQ
HMMSmart	IPR000299	91	322	SM00295	Band 4.1
HMMSmart	IPR002558	2345	2542	SM00307	I/LWEQ
ProfileScan	IPR000299	95	412	PS50057	Band 4.1
ProfileScan	IPR002558	2302	2542	PS50945	I/LWEQ
ScanRegExp	IPR000299	182	210	PS00660	Band 4.1
ScanRegExp	IPR000299	292	321	PS00661	Band 4.1

Primer_f	TGAAAGAGAAGATGGTTGGCG
Primer_r	AAACTTGTACTGCTGCTGCCG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TGAAAGAGAAGATGGTTGGCG
Primer_r	AAACTTGTACTGCTGCTGCCG
PCR product length	128 (0.3k) bp
PCR conditions	95 °C15 sec64 °C60 sec35 cycles