Order Kazusa clone(s) from : ![]() |
Product ID | ORK00829 |
---|---|
Accession No | AB037848 |
Description | synaptotagmin XIII, transcript variant 1 |
Clone name | fh02770 |
Vector information | |
cDNA sequence | DNA sequence (5145 bp) Predicted protein sequence (439 aa) |
HaloTag ORF Clone |
FHC00829
![]() |
Flexi ORF Clone | FXC00829 |
Source | Human fetal brain |
Rouge ID |
mKIAA1427
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 3752 bp |
---|---|
Genome contig ID | gi51511727r_45118428 |
PolyA signal sequence (AATAAA,-22) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 11 | r | 45218428 | 45264446 | 6 | 99.2 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000008 | 202 | 272 | PF00168 | C2 calcium-dependent membrane targeting |
IPR000008 | 317 | 407 | PF00168 | C2 calcium-dependent membrane targeting | |
HMMSmart | IPR000008 | 316 | 432 | SM00239 | C2 calcium-dependent membrane targeting |
ProfileScan | IPR000008 | 314 | 407 | PS50004 | C2 calcium-dependent membrane targeting |
![]() |
Primer_f | ATGGATTCTGCCTTTGGACCC |
---|---|
Primer_r | ATAAGGCTCCTGCTCAGATTC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |