KIAA1427

Product ID	ORK00829
Accession No	AB037848
Description	synaptotagmin XIII, transcript variant 1
Clone name	fh02770
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5145 bp) Predicted protein sequence (439 aa)
HaloTag ORF Clone	FHC00829
Flexi ORF Clone	FXC00829
Source	Human fetal brain
Rouge ID	mKIAA1427 by Kazusa Mouse cDNA Project

Length: 5145 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	3752 bp
Genome contig ID	gi51511727r_45118428
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- CCTTGCAGTGGTAAATAAAAAATTTCCAACAGGGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* CAGCTGCCTGGTGTTTTCTTTTTTTCCGTTTTACCTAATATTTTGGCATA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	11	r	45218428	45264446	6	99.2	Perfect prediction

Length: 439 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001104396	6.4e-176	98.2	similar to syna...	Macaca mulatta
Q7L8C5	2.5e-175	100.0	Synaptotagmin-1...	Homo sapiens
XP_521898	1.5e-174	99.5	hypothetical pr...	Pan troglodytes
XP_540764	3.9e-163	91.1	similar to syna...	Canis lupus fam...
AAI40519	1.5e-161	92.3	SYT13 protein [...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D38522	2.1e-15	25.7	KIAA0080
AB037763	2.6e-14	26.1	KIAA1342
AB023202	4.4e-06	23.9	KIAA0985

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000008	202	272	PF00168	C2 calcium-dependent membrane targeting
HMMPfam	IPR000008	317	407	PF00168	C2 calcium-dependent membrane targeting
HMMSmart	IPR000008	316	432	SM00239	C2 calcium-dependent membrane targeting
ProfileScan	IPR000008	314	407	PS50004	C2 calcium-dependent membrane targeting

Primer_f	ATGGATTCTGCCTTTGGACCC
Primer_r	ATAAGGCTCCTGCTCAGATTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-