KIAA1428

Product ID	ORK04145
Accession No	AB037849
Description	adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1
Clone name	fh02979s1
Vector information	The cDNA fragment was originally inserted at SalI-NotI site ... The cDNA fragment was originally inserted at SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR) and a RT-PCR product (1-1290) was subcloned upstream of the cDNA (1291-5901). The adjacent sequence to the 5' end of the cDNA is as follows: GGGCCCCCCC TCGAGGTCGA CCCACGCGGG CCGCGGGAAT TCGATT-5' end of cDNA.
cDNA sequence	DNA sequence (5901 bp) Predicted protein sequence (709 aa)
HaloTag ORF Clone	FHC04145
Flexi ORF Clone	FXC04145
Source	Human fetal brain
Rouge ID	mKIAA1428 by Kazusa Mouse cDNA Project
Note	We replaced fh02979, former representative clones for KIAA1428 with fh02979s1. (2002/5/10)

Length: 5901 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3771 bp
Genome contig ID	gi89161205f_57136952
PolyA signal sequence (AATAAA,-27)	+--------+--------+----*----+---- TAATGTATAATAAAGTCCATGATTTTTGTACAGTG
Flanking genome sequence (145576 - 145625)	----+--------+--------+--------+--------+----* TTTTTTAATGAAATATTTGATACTCTGAACTTTATTTCTCAAAGTAATTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	f	57236952	57282526	22	99.3	Perfect prediction

Length: 709 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_849075	98.3	similar to DCC-...	Canis lupus fam...
Q8K3H0	98.0	DCC-interacting...	Mus musculus
XP_516550	100.0	adaptor protein...	Pan troglodytes
AAI42496	97.7	APPL1 protein [...	Bos taurus
ACH47027	97.3	adaptor protein...	Sus scrofa

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051503	1.7e-12	24.1	KIAA1716
D26069	6.1e-11	23.2	KIAA0041
AB007860	7.4e-05	22.2	KIAA0400
D30758	0.00071	20.8	KIAA0050

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001849	278	375	PF00169	Pleckstrin-like
HMMPfam	IPR006020	502	633	PF00640	Phosphotyrosine interaction region
HMMSmart	IPR001849	278	377	SM00233	Pleckstrin-like
HMMSmart	IPR006020	497	636	SM00462	Phosphotyrosine interaction region
ProfileScan	IPR001849	277	375	PS50003	Pleckstrin-like
ProfileScan	IPR006020	502	638	PS01179	Phosphotyrosine interaction region

Primer_f	GTTTGTTGTCCTTAGCAGTAG
Primer_r	GTTACCTTCTGCCATTTCACC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-