KIAA1312

Product ID	ORK04046
Accession No	AB037733
Description	ADAM metallopeptidase with thrombospondin type 1 motif, 9
Clone name	fh11767
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5139 bp) Predicted protein sequence (1471 aa)
Source	Human fetal brain
Rouge ID	mKIAA1312 by Kazusa Mouse cDNA Project

Length: 5139 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	722 bp
Genome contig ID	gi89161205r_64410865
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- ACCCTTTTTAATGGTAATAAACCAGTAGTAATCAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGCATGATTATATTATTTTCAAACATCGTAATATGTTCATATCTGTATGA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	r	64510865	64647326	30	99.8	Perfect prediction

Length: 1471 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9P2N4	100.0	A disintegrin a...	Homo sapiens
AAO15765	99.9	a disintegrin-l...	Homo sapiens
XP_528704	99.6	ADAM metallopep...	Pan troglodytes
XP_001091856	99.3	similar to ADAM...	Macaca mulatta
XP_001488010	93.9	ADAM metallopep...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037767	2.9e-107	39.8	KIAA1346
AB014588	2e-92	46.0	KIAA0688
AB095949	1.6e-85	33.5	KIAA2029
AB002364	1.6e-72	32.5	KIAA0366
AB018305	5.8e-13	26.3	KIAA0762

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR013273	439	457	PR01857	Peptidase M12B
	IPR013273	555	574	PR01857	Peptidase M12B
	IPR013273	575	594	PR01857	Peptidase M12B
HMMPfam	IPR002870	5	49	PF01562	Peptidase M12B
	IPR001590	135	341	PF01421	Peptidase M12B
	IPR000884	434	484	PF00090	Thrombospondin
	IPR010294	595	713	PF05986	ADAM-TS Spacer 1
	IPR000884	841	895	PF00090	Thrombospondin
	IPR000884	898	950	PF00090	Thrombospondin
	IPR000884	953	976	PF00090	Thrombospondin
	IPR000884	1026	1051	PF00090	Thrombospondin
	IPR000884	1089	1137	PF00090	Thrombospondin
	IPR000884	1174	1225	PF00090	Thrombospondin
	IPR000884	1228	1281	PF00090	Thrombospondin
	IPR000884	1287	1322	PF00090	Thrombospondin
	IPR000884	1346	1367	PF00090	Thrombospondin
	IPR000884	1404	1454	PF00090	Thrombospondin
HMMSmart	IPR000884	433	485	SM00209	Thrombospondin
	IPR000884	723	778	SM00209	Thrombospondin
	IPR000884	780	828	SM00209	Thrombospondin
	IPR000884	842	896	SM00209	Thrombospondin
	IPR000884	897	946	SM00209	Thrombospondin
	IPR000884	952	1008	SM00209	Thrombospondin
	IPR000884	1028	1082	SM00209	Thrombospondin
	IPR000884	1084	1138	SM00209	Thrombospondin
	IPR000884	1174	1226	SM00209	Thrombospondin
	IPR000884	1227	1282	SM00209	Thrombospondin
	IPR000884	1286	1341	SM00209	Thrombospondin
	IPR000884	1343	1397	SM00209	Thrombospondin
	IPR000884	1400	1455	SM00209	Thrombospondin
ProfileScan	IPR001590	135	341	PS50215	Peptidase M12B
	IPR000884	430	485	PS50092	Thrombospondin
	IPR000884	720	778	PS50092	Thrombospondin
	IPR000884	839	896	PS50092	Thrombospondin
	IPR000884	897	946	PS50092	Thrombospondin
	IPR000884	949	1008	PS50092	Thrombospondin
	IPR000884	1024	1082	PS50092	Thrombospondin
	IPR000884	1083	1138	PS50092	Thrombospondin
	IPR000884	1170	1221	PS50092	Thrombospondin
	IPR000884	1224	1282	PS50092	Thrombospondin
	IPR000884	1283	1336	PS50092	Thrombospondin
	IPR000884	1339	1397	PS50092	Thrombospondin
	IPR000884	1398	1455	PS50092	Thrombospondin
ScanRegExp	IPR006025	273	282	PS00142	Peptidase M

Primer_f	GTAACCATCGTCAGCTCAGCC
Primer_r	CAGTTCACAGTGGCAAATCGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GTAACCATCGTCAGCTCAGCC
Primer_r	CAGTTCACAGTGGCAAATCGG
PCR product length	113 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles