KIAA1547

Product ID	ORK00861
Accession No	AB046767
Description	transducin-like enhancer of split 3, transcript variant 3
Clone name	fh14154
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5205 bp) Predicted protein sequence (863 aa)
HaloTag ORF Clone	FHC00861
Flexi ORF Clone	FXC00861
Source	Human fetal brain
Rouge ID	mKIAA1547 by Kazusa Mouse cDNA Project

Length: 5205 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	Warning

Integrity of 3' end

Length of 3'UTR	1821 bp
Genome contig ID	gi51511731r_68027670
PolyA signal sequence (AAGAAA,-15)	+--------+--------+----*----+---- AGAAGGGAGGGTGAGGGTAGAAGAAAGTTATTCTC
Flanking genome sequence (99999 - 99950)	----+--------+--------+--------+--------+----* CGAAGAAAAAAAGAATGAAAAGTCATTGTACTGAACTGTTTTTATATTTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	15	r	68127669	68177293	19	99.0	Perfect prediction

Length: 863 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG10089	100.0	transducin-like...	synthetic construct
XP_001174941	99.9	transducin-like...	Pan troglodytes
XP_877614	99.3	similar to tran...	Bos taurus
EAW77848	98.8	transducin-like...	Homo sapiens
AAH43247	97.8	TLE3 protein [H...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB033087	8e-106	81.4	KIAA1261

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001680	705	738	PD000018	WD40 repeat
FPrintScan	IPR001680	682	696	PR00320	WD40 repeat
	IPR001680	724	738	PR00320	WD40 repeat
	IPR009146	762	784	PR01850	Groucho/transducin-like enhancer
	IPR009146	785	803	PR01850	Groucho/transducin-like enhancer
	IPR009146	804	823	PR01850	Groucho/transducin-like enhancer
	IPR001680	806	820	PR00320	WD40 repeat
	IPR009146	824	843	PR01850	Groucho/transducin-like enhancer
	IPR009146	844	863	PR01850	Groucho/transducin-like enhancer
HMMPfam	IPR005617	104	239	PF03920	Groucho/TLE
	IPR001680	568	604	PF00400	WD40 repeat
	IPR001680	624	651	PF00400	WD40 repeat
	IPR001680	657	695	PF00400	WD40 repeat
	IPR001680	699	737	PF00400	WD40 repeat
	IPR001680	781	819	PF00400	WD40 repeat
	IPR001680	832	860	PF00400	WD40 repeat
HMMSmart	IPR001680	567	604	SM00320	WD40 repeat
	IPR001680	610	651	SM00320	WD40 repeat
	IPR001680	656	695	SM00320	WD40 repeat
	IPR001680	698	737	SM00320	WD40 repeat
	IPR001680	740	778	SM00320	WD40 repeat
	IPR001680	780	819	SM00320	WD40 repeat
	IPR001680	820	860	SM00320	WD40 repeat
ProfileScan	IPR001680	573	746	PS50294	WD40 repeat
	IPR001680	663	704	PS50082	WD40 repeat
	IPR001680	705	746	PS50082	WD40 repeat
	IPR001680	787	863	PS50294	WD40 repeat
ScanRegExp	IPR001680	682	696	PS00678	WD40 repeat
ScanRegExp	IPR001680	724	738	PS00678	WD40 repeat

Primer_f	CCAGCATATTCCAGTCTAAAG
Primer_r	GCTGGAGTTCTTGTTTAGTAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-