KIAA1457

Product ID	ORK01169
Accession No	AB040890
Description	phosphatidylinositol transfer protein, membrane-associated 2, transcript variant 2
Clone name	fh16161s1
Vector information	The cDNA fragment was originally inserted at SalI-NotI site ... The cDNA fragment was originally inserted at SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR) and a RT-PCR product (1-2026) was subcloned upstream of the cDNA (2027-6799). The adjacent sequence to the 5' end of the cDNA is as follows: GGGCCCCCCC TCGAGGCCGC-5' end of cDNA
cDNA sequence	DNA sequence (6799 bp) Predicted protein sequence (1359 aa)
HaloTag ORF Clone	FHC01169
Flexi ORF Clone	FXC01169
Source	Human fetal brain
Rouge ID	mKIAA1457 by Kazusa Mouse cDNA Project
Note	We replaced fh16161, former representative clones for KIAA1457 with fh16161s1. (2002/12/27)

Length: 6799 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2546 bp
Genome contig ID	gi89161190r_121933981
PolyA signal sequence (ATTAAA,-21)	+--------+--------+----*----+---- TGTCTGTTACACCAATTAAAGAAGCGGGAAGGCTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* CCTTCTGGATCTCTTTACTGCAGTGGCGACCGTGGGGCATGGTGGGATGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	12	r	122033981	122160996	25	99.5	Terminal No-hit

Length: 1359 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW98384	100.0	phosphatidylino...	Homo sapiens
XP_001100098	98.3	similar to phos...	Macaca mulatta
Q9BZ72	92.6	Membrane-associ...	Homo sapiens
XP_001100187	91.1	similar to phos...	Macaca mulatta
Q6ZPQ6	83.5	Membrane-associ...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051492	0.00073	22.8	KIAA1705

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001666	32	51	PR00391	Phosphatidylinositol transfer protein
	IPR001666	101	121	PR00391	Phosphatidylinositol transfer protein
	IPR001666	127	142	PR00391	Phosphatidylinositol transfer protein
	IPR001666	214	229	PR00391	Phosphatidylinositol transfer protein
	IPR001666	235	254	PR00391	Phosphatidylinositol transfer protein
HMMPfam	IPR001666	17	269	PF02121	Phosphatidylinositol transfer protein
	IPR004177	731	973	PF02862	DDHD
	IPR013209	1118	1249	PF08235	LNS2
HMMSmart	IPR013209	1118	1249	SM00775	LNS2
ProfileScan	IPR004177	731	973	PS51043	DDHD

Primer_f	CCCTCCACACTGAAAACACCC
Primer_r	TCGGCATGAAAACGGAATTGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CCCTCCACACTGAAAACACCC
Primer_r	TCGGCATGAAAACGGAATTGG
PCR product length	196 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles