KIAA0728

Product ID	ORK04834
Accession No	AB018271
Description	dystonin
Clone name	fh22477
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5680 bp) Predicted protein sequence (1637 aa)
Source	Human fetal brain
Rouge ID	mKIAA0728 by Kazusa Mouse cDNA Project
Note	We replaced hk03530, former representative clones for KIAA0728 with fh22477. (2002/5/10)

Length: 5680 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	766 bp
Genome contig ID	gi89161210r_56330996
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- AGAAAGCTATGAAATAAAACACGTCCCTTAACTGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTGCTATGGAATTAATTTTTTTTCCCCAGGGAAAACTAGTGTATTTTTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	6	r	56430996	56488311	31	99.9	Perfect prediction

Length: 1637 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
NP_056363	100.0	dystonin isofor...	Homo sapiens
O94833	100.0	Bullous pemphig...	Homo sapiens
NP_899236	100.0	dystonin isofor...	Homo sapiens
NP_001138243	100.0	dystonin isofor...	Homo sapiens
NP_001138242	100.0	dystonin isofor...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB007934	0	67.1	KIAA0465
AB023228	3.3e-15	19.9	KIAA1011
AB018339	2.1e-09	20.3	KIAA0796
AB008567	6.6e-09	21.7	KIAA0302
AB033077	4.9e-07	20.3	KIAA1251

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR002048	1260	1314	PD000012	Calcium-binding EF-hand
HMMPfam	IPR002017	1	96	PF00435	Spectrin repeat
	IPR002017	99	209	PF00435	Spectrin repeat
	IPR002017	239	318	PF00435	Spectrin repeat
	IPR002017	321	428	PF00435	Spectrin repeat
	IPR002017	431	537	PF00435	Spectrin repeat
	IPR002017	540	646	PF00435	Spectrin repeat
	IPR002017	649	755	PF00435	Spectrin repeat
	IPR002017	758	865	PF00435	Spectrin repeat
	IPR002017	872	973	PF00435	Spectrin repeat
	IPR002017	976	1082	PF00435	Spectrin repeat
	IPR002017	1085	1222	PF00435	Spectrin repeat
	IPR002048	1255	1283	PF00036	Calcium-binding EF-hand
	IPR002048	1291	1319	PF00036	Calcium-binding EF-hand
	IPR003108	1330	1408	PF02187	Growth-arrest-specific protein 2
HMMSmart	IPR002017	1	95	SM00150	Spectrin repeat
	IPR002017	102	208	SM00150	Spectrin repeat
	IPR002017	215	317	SM00150	Spectrin repeat
	IPR002017	324	427	SM00150	Spectrin repeat
	IPR002017	434	536	SM00150	Spectrin repeat
	IPR002017	543	645	SM00150	Spectrin repeat
	IPR002017	652	754	SM00150	Spectrin repeat
	IPR002017	761	864	SM00150	Spectrin repeat
	IPR002017	871	972	SM00150	Spectrin repeat
	IPR002017	979	1081	SM00150	Spectrin repeat
	IPR002017	1091	1221	SM00150	Spectrin repeat
	IPR002048	1255	1283	SM00054	Calcium-binding EF-hand
	IPR002048	1291	1319	SM00054	Calcium-binding EF-hand
	IPR003108	1330	1408	SM00243	Growth-arrest-specific protein 2
ProfileScan	IPR002048	1251	1286	PS50222	Calcium-binding EF-hand
ProfileScan	IPR002048	1287	1322	PS50222	Calcium-binding EF-hand
ScanRegExp	IPR002048	1264	1276	PS00018	Calcium-binding EF-hand
ScanRegExp	IPR002048	1300	1312	PS00018	Calcium-binding EF-hand

Primer_f	GCCACAGCACTACATCAATCC
Primer_r	GACTGCGTGTGGGTGTGTTTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GCCACAGCACTACATCAATCC
Primer_r	GACTGCGTGTGGGTGTGTTTG
PCR product length	168 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles